Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Resveratrol compares with melatonin in improving in vitro porcine oocyte maturation under heat stress

Resveratrol compares with melatonin in improving in vitro porcine oocyte maturation under heat... Background: Resveratrol, an important phyto-antioxidant commonly found in grapes, mulberry, and other plants, has a variety of functions including anti-aging, anti-cancer and anti-inflammatory activities. In the current study, we investigated the beneficial effects of resveratrol on in vitro porcine oocyte maturation under heat stress (HS). The effect of resveratrol, melatonin and their combination on alleviating HS was compared according to the maturation rate of oocytes and the development competence of embryos after parthenogenetic activation (PA). Results: Supplementation with resveratrol (2.0 μmol/L) not only improved the nuclear maturation but also raised the blastocyst rate of porcine embryos’ PA from oocytes that underwent HS by increasing their glutathione (GSH) level, reducing reactive oxygen species (ROS) and up-regulating the expression of Sirtuin 1 (SIRT1). It was also found −7 −7 that melatonin (10 mol/L) and the combination of resveratrol (2.0 μmol/L) plus melatonin (10 mol/L) exhibited more potent effects than resveratrol alone regarding their protective activities on oocyte maturation under HS. Conclusions: This study compared the efficiencies of resveratrol, melatonin and their combination for protecting porcine oocytes from heat stress. The mechanisms are attributed to the fact that each treatment may have different ability to regulate the synthesis of steroid hormones and the expression of mature related genes. Keywords: Combination, Maturation Melatonin, Oocyte, Porcine, Resveratrol Background secretion by luteal cells and increased the follicle-stimu- Although modern cooling systems are used for preserving lating hormone (FSH) [4]. The disruption of steroid hor- porcine, their fertility remains low. A critical issue for their mone secretion was caused by the abnormal expression of fertility failure is the poor quality of oocyte maturation. HS their synthetic genes in ovaries under heat stress [5]. Ozawa disrupts the synthesis of the steroid hormone involved in et al. observed that heat stress during the follicular recruit- the regulating mechanism of oocyte maturation. Roth et al. ment phase suppressed the subsequent growth to ovulation, found that heat stress retarded the growth of follicles [1] accompanied by decreased LH receptor level and estradiol and reduced steroid hormone production, which is related synthesis activity in the follicles [3]. Shimizu et al. reported to the low fertility of animals [1–3]. Wolfenson et al. re- that heat stress strongly inhibited gonadotropin receptor ported that HS caused relatively low plasma concentration levels and aromatase activities in granulosa cells. The estra- of the luteinizing hormone (LH), reduced progesterone diol levels in the follicular fluid of early antral, antral and preovulatory follicles were also reduced [6]. HS had nega- * Correspondence: gshliu@cau.edu.cn tive effects on oocyte maturation via down-regulation of Equal contributors the gene expression in steroid hormone synthesis or their National Engineering Laboratory for Animal Breeding, Key Laboratory of receptors. The disruption of the levels of steroid hormones Animal Genetics and Breeding of the Ministry of Agriculture, Beijing Key Laboratory for Animal Genetic Improvement, College of Animal Science and caused the mature failure of in vitro cultured oocytes. Technology, China Agricultural University, Beijing 100193, China Oxidative stress is another important factor that impedes Full list of author information is available at the end of the article the cytoplasmic and nuclear maturation of porcine oocyte © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 2 of 10 under HS. Nabenishi et al. reported heat stress on porcine systematically investigated. In addition, its efficiency against oocyte had an adverse effect on their developmental com- HS will be compared with melatonin, another potent anti- petence by increasing GSH content and inhibiting the pro- oxidant, and the combination of melatonin with resveratrol. duction of oocyte ROS [7]. Similar results were observed by Ozawa et al., who found that heat stress at the zygote stage Methods reduced the developmental ability of mouse embryos via Chemicals physiological changes in the maternal environment. These All chemicals used in this study were purchased from changes thus led to an increase in intracellular oxidative Sigma-Aldrich Co (Alcobendas, Madrid, Spain) unless stress on the embryo [8]. These phenomena also occurred otherwise indicated. in bovine oocytes, as reported by Sakatani et al. [9]. An increasing oxidative stress caused by HS in the oviduct was Animal studies possibly involved in heat stress-induced early embryonic All animal studies were conducted in accordance with the death [10]. HS retarded the nuclear maturation of oocytes, requirement of the Institutional Animal Care Committee resulting in the poor quality of oocytes, and thus reduced and have been approved by the Ethics Committee of the the potency of their development. Most ovine oocytes that China Agriculture University. matured under heat-shock conditions remained at the ger- minal vesicle breakdown (GVBD) stage, and they showed In vitro maturation an aberrant chromatin configuration in the research of Porcine ovaries were collected from the local abattoir (The Gharibzadeh [11]. Cherng et al. found that HS caused cer- Fifth Meat Co, Beijing) and immediately transported in tain unfavorable changes in the nucleus and cytoskeleton in saline (30 ºC) to the laboratory within 4 h. COCs (cu- porcine oocytes, which might be associated with reducing mulus-oocyte complexes) were aspirated from the folli- development under the hyperthermic condition and pos- cles (3–8 mm in diameter) using a 10 mL syringe fixed sibly with the low pregnancy rates in domestic species with an 18-gauge needle. Four or more layers of compact during hot seasons [12]. Payaton et al. observed that heat cumulus cells were used for in vitro maturation after stress of oocytes during the GV-stage reduced the pro- washing three times in HEPES-buffered Tyrode’s medium portion of oocytes that progressed to metaphase II after (TLH) containing 0.3 % (w/v) bovine serum albumin in vitro maturation (IVM). Heat treatment for 6 h de- (BSA). The COCs were matured (80–90 COCs/500 μL) in creased the proportion of 8- to 16-cell embryos, whereas the IVM medium (which consisted of TCM199 plus 0.3 % heat treatment for 12 h reduced blastocyst development (w/v) BSA containing 10 IU/mL equine chorionic gonado- [13]. Wang et al. found that spindle assembling was tropin and 10 IU/mL human chorionic gonadotropin, affected and MAD2 was activated in some of the mouse 0.57 mmol/L cysteine and 10 ng/mL epidermal growth oocytes that matured at 40.7 °C [14]. factor) at 38.5°Cin 5 % CO . Resveratrol (3,4,5-trihydroxy-trans-stilbene), an antifun- gal molecule of the stilbene family, is produced in a variety Assessment of polar body rate of plant species, particularly in grapes, in response to To assess the polar body of the metaphase II (MII) oocyte, pathogen attack or under stressful conditions such as UV the samples were collected after 44 h of maturation. The radiation [15]. Resveratrol is also a strong antioxidant, cumulus cells were removed by gently pipetting in the PBS- maintaining the levels of antioxidant enzymes such as PVA (0.1 % PVA) medium containing 0.1 % (w/v) hyaluron- glutathione peroxidase (GPx), superoxide dismutase idase. The oocytes were stained with Hoechst 33342 for (SOD), and catalase (CAT) [16, 17] and improving the 10 min. Then, the samples were rinsed with 0.1 % PVA- distribution and function of mitochondria [18]. All these DPBS medium three times, and were mounted on a clean are critical for oocyte maturation. As a phytoestrogen, glass slide, covered with a coverslip, and examined with an resveratrol has an equivocal role in regulating the level of inverted microscope (Nikon Corporation) equipped with estrogen by binding to estrogen receptors (ERs) and evok- epifluorescence. ing biological effects parallel to those exerted by endogen- ous and synthetic estrogens [19]. It functions as estrogen Parthenogenetic activation (PA) receptor agonist in different test systems [20]. Resveratrol After 44 h of maturation, cumulus cells were removed by can enhance the progesterone secretion and expression of gently pipetting in the PBS-PVA (0.1 % PVA) medium luteinization-related genes in the ovary [21]. Many studies containing 0.1 % (w/v) hyaluronidase. Denuded MII oocytes have shown that a supplement with resveratrol improves were washed 2–3 times in activation medium (0.28 mol/L oocyte maturation and the subsequent development in mannitol; 0.01 % polyvinyl alcohol; 0.05 mmol/L HEPES; mice [22], bovines [18, 23], goats [24] and porcines [25]. 0.1 mmol/L CaCl ·2H O and 0.1 mmol/L MgCl )before 2 2 2 In the current study, the potential effect of resveratrol on in PA. For activation, an electrical pulse (1.3 KV/cm, 80 μs) vitro porcine oocyte maturation under HS will be generated by a BTX Electro-Cell Manipulator 2001 (BTX, Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 3 of 10 San Diego, CA, USA) was applied to oocytes. After being apoptotic nuclei (by TUNEL assay) and the total numbers washed three times with PZM-3 (containing 7.5 μg/mL of nuclei were determined from optical images. The apop- cytochalasin B(CB) and 10 μg/mL cyclohexane (CHX)), the totic rate was calculated as follows: apoptotic rate = (num- oocytes were put into PZM-3 (containing 7.5 μg/mL CB ber of TUNEL-positive nuclei/total number of nuclei) × and 10 μg/mL CHX, 20 to 30 oocytes/60 μL) medium for 100 %. 4handthenwashed3timeswithPZM-3.Then, they were cultured for 7 d to evaluate their developmental compe- RNA isolation and quantitative real-time polymerase chain tence (cleavage rate at d 3 and blastocyst rate at d 7). reaction Fresh immature COCs were collected after HS, washed Measurement of intracellular ROS and GSH levels twice with DPBS solution and stored at −80 °C until the The IVM oocytes at the MII stage were sampled 44 h after RNA was extracted. The total RNA was extracted using IVM in a medium with different supplements (resveratrol, TRIzol reagent (Invitrogen Inc.,Carlsbad,CA,USA),quan- melatonin, and their combination) or without to determine tified by measuring the absorbance at 260 nm and stored at their intracellular ROS and GSH levels, as described by −80 °C until use. The levels of relevant mRNA, including Wang et al. [23]. Briefly, 2070-dichlorodihydrofluorescein the products of antioxidant-related genes, apoptosis-related diacetate (H2DCFDA; Beyotime Institute of Biotechnol- genes and maturation-related genes, were determined by ogy, Jiangsu, China) and 4-chloromethyl-6,8-difluoro-7- quantitative real-time polymerase chain reaction (RT-PCR) hydroxycoumarin (Cell Tracker Blue CMF2HC Molecular usingaOneStepSYBRPrime Script RT-PCR Kit(TaKaRa Probes; Beyotime Institute of Biotechnology) were used to Bio Inc., Tokyo, Japan) in a Light Cycler instrument (Roche, detect intracellular ROS as green fluorescence and the Mannheim, Germany). The levels of accumulated fluores- GSH level as blue fluorescence, respectively. A total of 25– cence were analyzed using the second derivative method 30 oocytes from each treatment group were incubated (in after the melting-curve analysis was complete. Then, the the dark) for 30 min in DPBS-PVA containing 10 mmol/L expression levels of the target genes were normalized to the H2DCFDA or 10 mmol/L Cell Tracker Blue. After incuba- expression level of actin in each sample. The primer pairs tion, the oocytes were washed with DPBS-PVA and placed for the analyzed mRNAs are listed in Table 1. in 10 μL droplets. Then, the fluorescence was observed using an epifluorescence microscope (TE300; Nikon) with Experimental procedures UV filters (460 nm for ROS and 370 nm for GSH). The All experiments were conducted in a heat-stress model fluorescent images were saved as graphic files in TIFF (42 °C, 20–24 h IVM) chosen from different HS strat- format. The fluorescence intensities of the oocytes were egies, which can significantly reduce the polar body rate analyzed using Image J software (version 1.40; National of oocytes and the blastocyte rate of porcine PA embryos Institutes of Health, Bethesda, MD) and normalized to that [26]. Resveratrol (0.5, 2.0, 5.0, and 10.0 μmol/L), melatonin −7 of the control. The experiment was replicated three times. (10 mol/L), which was set according to the previous −7 study [26], and the combination of melatonin (10 mol/ Apoptosis assays (TUNEL) and total cell counts of blastocyst L) and resveratrol (2.0 μmol/L) were added to the Apoptosis was detected by terminal deoxynucleotidyl transferase-mediated d-UTP nick end-labeling (TUNEL) Table 1 Primers used in this study assay. Briefly, 7-d-old embryos were washed three times in Gene Primer sequence(5’-3’) T (°C) Size,bp DPBS-PVP (DPBS supplemented with 0.1 % polyvinylpyr- β-actin Forward: GTGGACATCAGGAAGGACCTCTA 60.0 131 rolidone) and fixed in 4 % (v/v) paraformaldehyde solution Reverse: ATGATCTTGATCTTCATGGTGCT for 1 h at room temperature. Membranes were made HSP70 Forward: TTCGACGTGTCCATCCTGACG 60.0 169 permeable in 0.1 % Triton X-100 in 0.1 % citrate solution Reverse: TCACCGCCCGCTTGTTCTGG for 1 h at room temperature. Fixed embryos were incubated Sphk1 Forward: CCAGGTGCACCCAAACTACT 60.0 92 in TUNEL reaction medium (In Situ Cell Death Detection Reverse: GAGGCTTCTGGCTGAGTGAG Kit, Fluorescein; Roche, Mannheim, Germany) for 1 h SOD1 Forward: TCCATGTCCATCAGTTTGGA 60.0 131 Reverse: AGTCACATTGGCCCAGGTCTC at 38.5°Cin the dark.Therefore,the broken DNAends of the embryonic cells were labeled with TdT and CYP11A Forward:TGGTGACAATGGCTGGATTAACCT 60.0 376 Reverse: GACGAAGTCCTGAGACACTGTGT fluorescein-dUTP. After the reaction stopped, the embryos were washed in DPBS-PVA and mounted on glass slides CYP19 Forward: GTCGTGGACTTCGTCATG 60.0 257 Reverse: AGTGTGACCAAGATGACCTT with DAKO Fluorescent Mounting Medium (S3023, Dako SIRT1 Forward: TTGATCTTCTCATTGTTATTGGGTC 60.0 62 North America, Carpinteria, CA, USA) containing Hoechst Reverse: ACTTGGAATTAGTGCTACTGGTCTTA 33342 for total cell counts. Whole-mount embryos were Akt2 Forward: AAAGTCATCCTGGTGCG 60.0 136 examined under an epifluorescence microscope (Nikon) by Reverse: GGGTGCCTGGTGTTCTG TUNEL assay and Hoechst staining. The numbers of Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 4 of 10 maturation solution. The intracellular levels of ROS and 0.05), and there were no obvious changes in the 0.5 and GSH, the total number of blastocysts, the apoptosis cell 5.0 μmol/L resveratrol-treated groups (61.82 ± 1.41 % and rate in blastocysts, and the expression of genes associated 64.01 ± 0.76 %; P > 0.05). In contrast, the 10.0 μmol/L res- with oxidation apoptosis maturation were tested to com- veratrol group had the lowest polar body rate (53.95 ± pare the efficiency of resveratrol and melatonin and their 0.01 %; Fig. 1a). combination to protect porcine oocyte from HS. After PA, the cleavage rate of embryos from oocytes with heat treatment was significantly lower than that of Statistics analysis embryos from the non-HS group (76.78 ± 1.49 % vs 82.64 Data are expressed as the mean ± S.E.M. Statistical ana- ±3.18 %; P < 0.05). The cleavage rate of resveratrol-treated lyses were performed using univariate analysis of variance groups failed to increase (68.88 ± 1.01 %, 73.92 ± 8.38 %, (ANOVA) with the aid of SPSS 19.0 statistical software, and 72.77 ± 6.86; P > 0.05; Fig. 1b). On the other hand, followed by Student’s t-test. P < 0.05 was considered sig- heat stress significantly reduced the blastocyst rate of em- nificant, and P < 0.01 was considered highly significant. bryos after PA (18.28 ± 0.66 % vs 43.48 ± 3.07 %; P < 0.05), and the supplement with 2.0, 5.0, and 10.0 μmol/L resver- Results atrol enhanced the blastocyst rate significantly (28.27 ± Effect of resveratrol on maturation of porcine oocytes under 1.02 %, 24.75 ± 1.52 %, and 23.25 ± 1.50 %; P < 0.05; heat stress Fig. 1c). A total of 1098 oocytes (more than six replications) under- went maturation with or without heat treatment with dif- Effects of resveratrol, melatonin and their combination on ferent concentrations of resveratrol (0.5, 2.0, 5.0, and maturation of porcine oocyte under heat stress −7 10.0 μmol/L). After maturation (IVM 44 h), the polar Melatonin (10 mol/L), resveratrol (2.0 μmol/L) and their body rates were tested. The results showed that the polar combination were selected to compare their ability against body rate of oocytes that underwent heat stress (HS heat stress. The results showed that the polar body rates group) was significantly lower than that of the non-HS of the melatonin group (M-HS) and the combination group (67.32 ± 0.30 % and 61.62 ± 1.39 %, respectively; group (M + R-HS) were significantly higher than those of P < 0.05). The polar body rate at the 2.0 μmol/L resvera- the non-HS group (72.37 ± 1.44 % and 75.57 ± 1.17 % vs trol (R) group was significantly higher (70.62 ± 0.87, P < 67.47 ± 1.44 %; P < 0.05). The polar body rate of the Fig. 1 Effect of different concentrations of resveratrol on the PB1 rate of porcine oocyte and development competence after PA. a Effect of different concentrations of resveratrol on the PB rate. b Effect of different concentrations of resveratrol on the cleavage rate of porcine PA embryo. c Effect of different concentrations of resveratrol on the blastocyst rate of porcine PA embryo. d Blastocyst from non-heat stress, heat stress and resveratrol (2.0 μmol/L). bar = 100 μm. non-HS: non-heat stress; HS: heat stress; R:resvertrol Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 5 of 10 resveratrol group (R-HS) was significantly higher than that than that in heat stress group (0.1118 ± 0.0129 pixels/oo- of the HS group (68.53 ± 0.75 % vs 59.08 ± 0.31 %; P < cytes vs 0.1706 ± 0.0087 pixels/oocytes; P < 0.05). These 0.05). The data indicated that resveratrol, melatonin and data indicated that all the treatments of resveratrol, their combination could improve the polar body rate, melatonin and their combination could help to relieve which was reduced by heat stress, and the effects of mela- oocytes from heat stress. The effect of either melatonin tonin and the combination on the polar body rate were or resveratrol was significantly higher than their com- significantly higher than those of resveratrol alone bination (Fig. 2c). (Fig. 2a). The intracellular levels of GSH in the oocytes in the Comparison of different treatments on the equality of PA melatonin and resveratrol groups were significantly higher embryo than those in the non-HS group (0.3262 ± 0.0071 and After PA, the cleavage rates of embryos from oocytes sup- 0.3302 ± 0.0076 pixels/oocytes vs 0.2837 ± 0.0069 pixels/ plemented with melatonin, resveratrol and their combin- oocytes, respectively; P < 0.05). The GSH level of the oo- ation had no significant changes compared with the HS cytes in the combination group was lower than the GSH group (76.11 ± 1.58 %, 74.57 ± 2.32 %, and 72.69 ± 2.81 % vs level of those in melatonin or resveratrol alone groups; 74.75 ± 1.04 %, respectively; P > 0.05). The cleavage rates however, it was still significantly higher than that in the were significantly lower than those of embryos from the heat stress group (0.2975 ± 0.0079 pixels/oocytes vs 0.1543 non-HS group (91.67 ± 1.31 %, P < 0.05). However, heat ± 0.0062 pixels/oocytes; P < 0.05) and similar to the level of stress significantly reduced the blastocyst rate of embryos the non-HS group (Fig. 2b). Consistent with this finding, after PA (20.51 ± 0.58 % vs 32.77 ± 2.33 %; P < 0.05), and the ROS level was significantly lower in the melatonin- and the supplementations of melatonin, resveratrol and their resveratrol-treated samples than that in non-HS groups combination raised the blastocyst rate significantly (0.0728 ± 0.0124 and 0.0715 ± 0.0067 pixels/oocytes vs 0.13 (26.03 ± 1.63 %, 25.32 ± 1.33 %, and 28.66 ± 0.94 %, re- 36 ± 0.0091 pixels/oocytes, respectively; P < 0.05). The ROS spectively; P < 0.05). The blastocyst rate in the combin- level in the combination group was also significantly lower ation group was not significantly different from that of Fig. 2 Effect of different supplements on the maturation of porcine oocytes under HS. a Effect of different supplements on the PB1 rate of porcine oocyte. b Effect of different supplements on the GSH level. c Effect of different supplements on the ROS level. d Effect of different supplements on the ROS and GSH levels. non-HS: non-heat stress; HS: heat stress; M-HS: supplement melatonin under heat stress; R-HS: supplement resveratrol under heat stress; M + R-HS: under heat stress melatonin and resveratrol under heat stress Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 6 of 10 the non-HS group (P > 0.05). The combination of mela- Different supplements on the expression of genes in COCs tonin and resveratrol was the most effective treatment The level of HSP70 gene expressed in the COCs was sig- regarding the increasing blastocyst rate under the HS nificantly higher in the heat-treatment group than that in (Fig. 3a). the non-HS group (P < 0.05). Melatonin, resveratrol and Heat stress significantly reduced the total cell number their combination did not significantly affect the HSP70 of blastocysts compared to the non-HS group (41.96 ± gene expression when compared with HS group (P > 0.05; 3.17 vs 53.44 ± 2.65; P < 0.05), whereas the melatonin Fig. 4a). Regarding antioxidant-related gene SOD1 and and combination groups preserved the total cell num- apoptosis-related gene SPKH1, heat stress significantly berata similarlevelto thenon-HSgroup (52.90±3.84 enhanced their expressions (P < 0.05), whereas treatments and 55.26 ± 3.91; P < 0.05). The total cell number of with melatonin, resveratrol or their combination did not blastocysts in the resveratrol group (49.9 ± 3.56) was modify the expression levels of these genes, which were not significantly different from that of the non-HS up-regulated by HS (P > 0.05; Fig. 4b). Melatonin, resvera- group or the heat stress group (P >0.05; Fig. 3b). How- trol and their combination significantly raised the expres- ever, the heat stress group had a significantly higher sion of SIRT1 compared with the non-HS and HS group apoptosis cell number than the non-HS group (2.21 ± (P < 0.05; Fig. 4c). As to the genes involved in steroidogen- 0.35 vs 1.31 ± 0.11; P < 0.05). The melatonin, resveratrol esis, CYP11A and CYP19 were reported to be expressed in and combination groups significantly reduced apoptotic cumulus cells and take part in the synthesis of progesterone cells (1.46 ± 0.22, 1.40 ± 0.31, and 1.46 ± 0.22, respect- and estrogen, respectively [27, 28]. Heat stress reduced the ively; P < 0.05; Fig. 3c). The apoptotic cell rate showed a expression of CYP11A. The melatonin and combination similar tendency to the apoptotic cells in different groups showed strong abilities in up-regulating the expres- treated groups (6.00 ± 1.26 % vs 2.88 ± 0.38 %, 2.93 ± sion of CYP11A to the level of the non-HS group, whereas 0.41 %, 3.48 ± 1.07 % and 3.08 ± 0.78 %, respectively; resveratrol had no significant effect in up-regulating the P < 0.05;Fig. 3d). expression of this gene (P > 0.05). All treatments had no Fig. 3 Effect of different supplements on the quality of PA embryo from oocyte under HS. a Effect of different supplements on the development competence of PA embryo from oocyte under HS. b Effect of different supplements on the cell number of blastocysts. c Effect of different supplements on the apoptotic cell number of blastocysts. d Effect of different supplements on the apoptotic cell rate of blastocysts. non-HS: non-heat stress; HS: heat stress; M-HS: supplement melatonin under heat stress; R-HS: supplement resveratrol under heat stress; M + R-HS: under heat stress melatonin and resveratrol under heat stress Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 7 of 10 Fig. 4 Effect of different supplements on the expression of genes. a Effect of different supplements on the expression of HSP70. b Effect of different supplements on the expression of genes associated with antioxidants and apoptosis. c Effect of different supplements on the expression of SIRT1. d Effect of different supplements on the expression of genes associated with the synthesis of steroid hormones. non-HS: non-heat stress; HS: heat stress; M-HS: supplement melatonin under heat stress; R-HS: supplement resveratrol under heat stress; M + R-HS: under heat stress melatonin and resveratrol under heat stress significant effects on the expression of CYP19 (P > 0.05; [25]. These authors reported that resveratrol failed to in- Fig. 4d). crease the polar body rate of porcine oocytes in the normal case. However, our data showed that resveratrol (2.0 μmol/ Discussion L) improved nuclear maturation, which indicated resvera- In the current study, we found that the polar body rate, an trol had a direct effect for protecting porcine oocytes from index of the nucleus maturation of porcine oocytes, was HS by reducing the high level of ROS and helping them retarded by heat stress. Resveratrol (2.0 μmol/L) relieved produce more GSH. In a word, it provided a proper envir- the adverse effect and increased the proportion of oocytes onment for nuclear maturation. We also found that resver- that had matured into the MII stage (Fig. 1a). This effect of atrol (2.0 μmol/L) enhanced the expression of SIRT1 resveratrol may attribute its ability to be an antioxidant. (Fig. 4c), which had been observed in cows [23] and mice Resveratrol has a strong capacity to reduce oxidant damage [22]. SIRT1 was reported to associate with regulating au- [29]. It improves the maturation environment by alleviating tophagy and mitochondrial function in cells upon oxidative the high level of ROS in heat-treated porcine oocytes. Our stress [30]. Resveratrol was found to improve mitochondrial results confirmed that resveratrol (2.0 μmol/L) not only function by activating SIRT1 [31, 32]. This finding was con- scavenged ROS but also improved the intracellular GSH firmed in the current study; i.e., the expression of SIRT1 level of oocytes to further fight oxidative stress (Fig. 2b-c). was up-regulated by resveratrol under HS. Our data indi- This finding was consistent with the result of Kwak et al. cated that resveratrol (2.0 μmol/L) promoted the nucleus Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 8 of 10 maturation of porcine oocytes by reducing the oxidant oxidase to ease some neurodegenerative diseases [38]. In stress caused by heat, and it ensured cytoplasm maturation the current study, we observed that melatonin was more by improving the function of mitochondria through SIRT1. potent than resveratrol in increasing the polar body rate Resveratrol (2.0 μmol/L) promoted the development under the condition of HS (Fig. 2a). This finding was con- competence of embryos PA from oocytes that underwent sistent with the observations of others [36, 37]. The poten- HS with a higher blastocyst rate (Fig. 1c) and quality tial mechanisms may contribute to melatonin’sfavorable (Fig. 3b, c, d), which was also reported in bovines [23], distribution in both the lipid and water phases [39] and its goats [24], mice [22], and porcines [25]. Resveratrol pre- cascade reaction with free radicals [40]. The significantly vented cells from apoptosis (Fig. 3c-d). Kong et al. reported weaker ability of resveratrol in comparison to melatonin that resveratrol delayed oocyte nest breakdown and inhib- to up-regulate the expression of CYP11A under heat stress ited both the primordial-to-developing follicle transition could be another reason (Fig. 4d). As we all know, mela- and apoptosis by decreasing the activation of Foxo3a, Bim, tonin is a hormone that can be synthesized in mammals, and p27KIP1 [33]. Bucci et al. observed that resveratrol and its receptors are found in many organs, tissues, and modulated the porcine oocyte apoptotic process caused by cells, such as oocyte [41]. Melatonin functions through its cryopreservation-induced damage [34].Notably,resveratrol receptors, for example, promoting bovine embryo devel- didn’t show dose effect. The 2.0 μmol/L was the most effi- opment in vitro by MT1 [32]. By contrast, resveratrol is cient concentration that protected the porcine oocyte from merely a type of phytohormone without a receptor in HS during maturation. Resveratrol of other concentrations animals. We also observed the synergistic effect of mela- showed little or even an adverse effect. The same results tonin and resveratrol in terms of their protective effects were observed by Wang et al.[23]. They found that substan- on in vitro porcine oocyte maturation under HS. However, tially high concentrations of resveratrol might have a nega- similarly to the melatonin and resveratrol groups, the tive effect on bovine oocyte maturation, which might be combination showed no significant improvement in the caused by the competitive inhibition of the activities of cleavage rate (Fig. 3a). It increased the blastocyst rate, the various phosphodiesterases, resulting in an increase in the endpoint for the in vitro development of embryos, under concentration of cytosolic cAMP. By contrast, 10.0 μmol/L HS at the greatest extent compared with melatonin and resveratrol failed to regulate the synthesis of steroid resveratrol alone (Fig. 3a), showing no significant differ- hormones, ultimately lead to retarding oocyte maturation ence from the non-HS group. This may have been caused [23, 35]. by the right ability combination to balance the ROS and There were few studies to compare the efficiency of mela- GSH to the levels of the non-HS group, as shown in tonin and resveratrol on the oocyte maturation under the Fig. 2b-c. As we all know, ROS takes part in some physio- in vitro condition. Ebly et al. showed that melatonin was logical pathway, such as activating the cascade signal in more potent than resveratrol in promoting the expression cells [42]. Therefore, a proper level of ROS was needed. and activity of GSH and glutathione peroxidase in liver, The large rate of GSH/ROS when supplement melatonin whereas in the activation of liver catalase, resveratrol was or resveratrol alone may have caused the final failure to stronger than melatonin [36]. López et al. [37] compared increase the blastocyst rate to the level of the non-HS the effect of melatonin and other antioxidants in reducing group, whereas the combination group achieved it. These DNA damage. They found that 100 μmol/L resveratrol results provide valuable information regarding how to use could reduce 78 ± 4 % 8-OH-dG (an indicator of cell DNA well-known antioxidants to protect oocytes from oxidative damage), but the IC50 (half inhibitory concentration) of stress under unfavorable conditions, including the HS and resveratrol was 10.9 ± 0.3 μmol/L, which is three times in vitro maturation. It seems that the different maturation higher than that of melatonin. They also found that mela- stages of oocytes require different antioxidant strategies. tonin could eliminate the oxidation damage produced by For example, in certain maturation stages, melatonin or low doses of resveratrol, and supplementation with mela- resveratrol alone provides better protection, and in other tonin and resveratrol together did not show a synergistic stages, their combination is more suitable. These will be effect on DNA protection. Our results also showed that our future projects of investigation. their combination, despite significantly reducing the level of ROS and increasing the level of GSH compared with the Conclusions heat stress group, was significant weaker in changing the Resveratrol (2.0 μmol/L) protected porcine oocyte mat- level of ROS and GSH than supplementation with mela- uration in vitro from heat stress (IVM 20–24 h, 42 °C) tonin or resveratrol alone (Fig. 2b-c). by significantly eliminating ROS, increasing GSH, and Melatonin can work synergistically with vitamin C [37]. up-regulating the expression of SIRT1. Comparatively, −7 Other research showed that melatonin can strengthen the melatonin (10 mol/L) and the combination were more nerve protective effect of resveratrol by inhibiting protease potent in alleviating the adverse effects of HS on the ubiquitin-proteasome, which can promote hemoglobin polar body rate than was resveratrol alone. With the Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 9 of 10 combined treatment, the polar body rate was even higher 10. MATSUZUKA T, OZAWA M, NAKAMURA A, USHITANI A, HIRABAYASHI M, KANAI Y. Effects of heat stress on the redox status in the oviduct and early than that of the controls. Melatonin, resveratrol and their embryonic development in mice. J Reprod Dev. 2005;51:281–7. combination failed to improve the cleavage rate of the PA 11. Gharibzadeh Z, Riasi A, Ostadhosseini S, Hosseini SM, Hajian M, Nasr- embryo, but they raised the blastocyst rate compared to Esfahani MH. Effects of heat shock during the early stage of oocyte maturation on the meiotic progression, subsequent embryonic the group under HS, and the combination group had the development and gene expression in ovine. Zygote. 2015;23:573–82. strongest ability in this respect. Melatonin and the com- 12. Ju JC, Tseng JK. Nuclear and cytoskeletal alterations of in vitro matured bination increased the total cell number of blastocysts to a porcine oocytes under hyperthermia. Mol Reprod Dev. 2004;68:125–33. 13. Payton RR, Romar R, Coy P, Saxton AM, Lawrence JL, Edwards JL. higher level than resveratrol did, and they all effectively Susceptibility of bovine germinal vesicle-stage oocytes from antral follicles reduced apoptosis under HS. Generally, the combination to direct effects of heat stress in vitro. Biol Reprod. 2004;71:1303–8. was stronger than melatonin in the efficiency of alleviating 14. Wang J, Sui H, Miao D, Liu N, Zhou P, Ge L, et al. Effects of heat stress during in vitro maturation on cytoplasmic versus nuclear components of the adverse effect of heat stress on porcine oocyte, and mouse oocytes. Reproduction. 2009;137:181–9. melatonin was stronger than resveratrol. 15. Tellone E, Galtieri A, Russo A, Giardina B, Ficarra S. Resveratrol: A Focus on Several Neurodegenerative Diseases. Oxid Med Cell Longev. 2015;2015:1–14. Acknowledgements 16. Yen G, Duh P, Lin C. Effects of resveratrol and 4-hexylresorcinol on This research was supported by programs for the 973 National Basic hydrogen peroxide-induced oxidative DNA damage in human lymphocytes. Research Program of China (2014CB138505) and the Open Foundation of Free Radical Res. 2003;37:509–14. State Key Laboratory of Animal Nutrition (2004DA115184F1415). 17. Rege SD, Kumar S, Wilson DN, Tamura L, Geetha T, Mathews ST, et al. Resveratrol Protects the Brain of Obese Mice from Oxidative Damage. Oxid Authors’ contributions Med Cell Longev. 2013;2013:419092. YL carried out the experiment (design), data interpretation and manuscript 18. Takeo S, Sato D, Kimura K, Monji Y, Kuwayama T, Kawahara-Miki R, et al. writing. JW and ZZZ participated in the culture of oocytes and embryos. Resveratrol improves the mitochondrial function and fertilization outcome They also did some manuscript writing. JYY, FW and XZT participated in the of bovine oocytes. J Reprod Dev. 2014;60:92–9. experiment design. JW, ZZZ, and CJH participated in the molecular genetic 19. Henry LA, Witt DM. Effects of neonatal resveratrol exposure on adult male and studies. All authors contributed to the oocyte collection. All authors read and female reproductive physiology and behavior. Dev Neurosci. 2005;28:186–95. approved the final manuscript. 20. Gehm BD, McAndrews JM, Chien P, Jameson JL. Resveratrol, a polyphenolic compound found in grapes and wine, is an agonist for the estrogen Competing interests receptor. Proc Natl Acad Sci U S A. 1997;94:14138–43. The authors declare that they have no competing interests. 21. Morita Y, Wada-Hiraike O, Yano T, Shirane A,HiranoM,Hiraike H, et al.Resveratrol promotes expression of SIRT1 and StAR in rat ovarian granulosa cells: an Author details 1 implicative role of SIRT1 in the ovary. Reprod Biol Endocrinol. 2012;10:14–30. National Engineering Laboratory for Animal Breeding, Key Laboratory of 22. Liu Y, He X, Huang X, Ding L, Xu L, Shen Y, et al. Resveratrol protects mouse Animal Genetics and Breeding of the Ministry of Agriculture, Beijing Key oocytes from methylglyoxal-induced oxidative damage. PLoS One. 2013;8, e77960. Laboratory for Animal Genetic Improvement, College of Animal Science and 2 23. Wang F, Tian X, Zhang L, He C, Ji P, Li Y, et al. Beneficial effect of resveratrol Technology, China Agricultural University, Beijing 100193, China. College of on bovine oocyte maturation and subsequent embryonic development Animal Science and Technology, Jilin Agricultural University, Changchun, after in vitro fertilization. Fertil Steril. 2014;101:577–86. Jilin, China. 24. Mukherjee A, Malik H, Saha AP, Dubey A, Singhal DK, Boateng S, et al. Resveratrol treatment during goat oocytes maturation enhances Received: 12 January 2016 Accepted: 19 May 2016 developmental competence of parthenogenetic and hand-made cloned blastocysts by modulating intracellular glutathione level and embryonic gene expression. J Assist Reprod Gen. 2014;31:229–39. References 25. Kwak S, Cheong S, Jeon Y, Lee E, Choi K, Jeung E, et al. The effects of 1. Roth Z, Meidan R, Shaham-Albalancy A, Braw-Tal R, Wolfenson D. Delayed resveratrol on porcine oocyte in vitro maturation and subsequent effect of heat stress on steroid production in medium-sized and embryonic development after parthenogenetic activation and in vitro preovulatory bovine follicles. Reproduction. 2001;121:745–51. fertilization. Theriogenology. 2012;78:86–101. 2. Wolfenson D, Lew BJ, Thatcher WW, Graber Y, Meidan R. Seasonal and 26. Li Y, Zhang Z, He C, Zhu K, Xu Z, Ma T, et al. Melatonin protects porcine acute heat stress effects on steroid production by dominant follicles in oocyte in vitro maturation from heat stress. J Pineal Res. 2015;59(3):365–75. cows. Anim Reprod Sci. 1997;47:9–19. 27. Millier SG, Whitelaw PF, Smyth CD. Follicular oestrogen synthesis: the ‘two- 3. Ozawa M, Tabayashi D, Latief TA, Shimizu T, Oshima I, Kanai Y. Alterations in cell, two-gonadotrophin’model revisited. Mol Cell Endocrinol. 1994;100:51–4. follicular dynamics and steroidogenic abilities induced by heat stress during 28. Drummond AE. The role of steroids in follicular growth. Reprod Biol follicular recruitment in goats. Reproduction. 2005;129:621–30. Endocrin. 2006;4:1435–41. 4. Wolfenson D, Roth Z, Meidan R. Impaired reproduction in heat-stressed 29. Liu FC, Tsai HI, Yu HP. Organ-Protective Effects of Red Wine Extract, cattle: basic and applied aspects. Anim Reprod Sci. 2000;60:535–47. Resveratrol, in Oxidative Stress-Mediated Reperfusion Injury. Oxid Med Cell 5. Argov N, Moallem U, Sklan D. Summer heat stress alters the mRNA Longev. 2015;2015:568634. expression of selective-uptake and endocytotic receptors in bovine ovarian 30. Ou X, Lee MR, Huang X, Messina GS, Broxmeyer HE. SIRT1 Positively cells. Theriogenology. 2005;64:1475–89. Regulates Autophagy and Mitochondria Function in Embryonic Stem Cells 6. Shimizu T, Ohshima I, Ozawa M, Takahashi S, Tajima A, Shiota M, et al. Heat stress Under Oxidative Stress. Stem Cells. 2014;32:1183–94. diminishes gonadotropin receptor expression and enhances susceptibility to 31. Marie L, Carmen A, Zachary GH, Hamid M, Carles L, Frederic D, et al. apoptosis of rat granulosa cells. Reproduction. 2005;129:463–72. Resveratrol improves mitochondrial function and protects against metabolic 7. Nabenishi H, Ohta H, Nishimoto T, Morita T, Ashizawa K, Tsuzuki Y. The disease by activating SIRT1 and PGC-1alpha. Cell. 2006;127:1109–22. effects of cysteine addition during in vitro maturation on the 32. Xu Y, Nie L, Yin YG, Tang JL, Zhou JY, Li DD, et al. Resveratrol protects against developmental competence, ROS, GSH and apoptosis level of bovine hyperglycemia-induced oxidative damage to mitochondria by activating SIRT1 oocytes exposed to heat stress. Zygote. 2012;20:249–59. in rat mesangial cells. Toxicol Appl Pharmacol. 2011;259:395–401. 8. Ozawa M, Hirabayashi M, Kanai Y. Developmental competence and oxidative state of mouse zygotes heat-stressed maternally or in vitro. 33. Kong X, Fu Y, Xu J, Zhuang X, Chen Z, Luo L. Resveratrol, an effective Reproduction. 2002;124:683–9. regulator of ovarian development and oocyte apoptosis. J Endocrinol Invest. 9. Sakatani M, Kobayashi SI, Takahashi M. Effects of heat shock on in vitro 2011;34:e374–81. development and intracellular oxidative state of bovine preimplantation 34. Bucci D. Effects of resveratrol on vitrified porcine oocytes. Oxid Med Cell embryos. Mol Reprod Dev. 2004;67:77–82. Longev. 2013;48:102. Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 10 of 10 35. Park S, Ahmad F, Philp A, Baar K, Williams T, Luo H, et al. Resveratrol ameliorates aging-related metabolic phenotypes by inhibiting cAMP phosphodiesterases. Cell. 2012;148:421–33. 36. Eybl V, Kotyzova D, Koutensky J. Comparative study of natural antioxidants– curcumin, resveratrol and melatonin–in cadmium-induced oxidative damage in mice. Toxicology. 2006;225:150–6. 37. López Burillo S, Tan DX, Mayo JC, Sainz RM, Manchester LC, Reiter RJ. Melatonin, xanthurenic acid, resveratrol, EGCG, vitamin C and α-lipoic acid differentially reduce oxidative DNA damage induced by Fenton reagents: a study of their individual and synergistic actions. J Pineal Res. 2003;34:269–77. 38. Kwon KJ, Kim JN, Kim MK, Lee J, Ignarro LJ, Kim HJ, et al. Melatonin synergistically increases resveratrol‐induced heme oxygenase‐1 expression through the inhibition of ubiquitin‐dependent proteasome pathway: a possible role in neuroprotection. J Pineal Res. 2011;50:110–23. 39. Karbownik M, Lewinski A, Reiter RJ. Anticarcinogenic actions of melatonin which involve antioxidative processes: comparison with other antioxidants. Int J Biochem Cell B. 2001;33:735–53. 40. Tan DX, Manchester LC, Terron MP, Flores LJ, Reiter RJ. One molecule, many derivatives: A never-ending interaction of melatonin with reactive oxygen and nitrogen species? J Pineal Res. 2007;42:28–42. 41. Sampaio RV, Conceição S, Miranda MS, Sampaio Lde F, Ohashi OM. MT3 melatonin binding site, MT1 and MT2 melatonin receptors are present in oocyte, but only MT1 is present in bovine blastocyst produced in vitro. Reprod Biol Endocrinol. 2012;10:103. 42. Combelles CM, Gupta S, Agarwal A. Could oxidative stress influence the in- vitro maturation of oocytes? Reprod Biomed Online. 2009;18:864–80. Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries � Our selector tool helps you to find the most relevant journal � We provide round the clock customer support � Convenient online submission � Thorough peer review � Inclusion in PubMed and all major indexing services � Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Animal Science and Biotechnology Springer Journals

Resveratrol compares with melatonin in improving in vitro porcine oocyte maturation under heat stress

Download PDF
10 pages

Loading next page...
 
/lp/springer-journals/resveratrol-compares-with-melatonin-in-improving-in-vitro-porcine-sBcD8h525d

References (41)

Publisher
Springer Journals
Copyright
Copyright © 2016 by The Author(s).
Subject
Life Sciences; Agriculture; Biotechnology; Food Science; Animal Genetics and Genomics; Animal Physiology
eISSN
2049-1891
DOI
10.1186/s40104-016-0093-9
pmid
27274843
Publisher site
See Article on Publisher Site

Abstract

Background: Resveratrol, an important phyto-antioxidant commonly found in grapes, mulberry, and other plants, has a variety of functions including anti-aging, anti-cancer and anti-inflammatory activities. In the current study, we investigated the beneficial effects of resveratrol on in vitro porcine oocyte maturation under heat stress (HS). The effect of resveratrol, melatonin and their combination on alleviating HS was compared according to the maturation rate of oocytes and the development competence of embryos after parthenogenetic activation (PA). Results: Supplementation with resveratrol (2.0 μmol/L) not only improved the nuclear maturation but also raised the blastocyst rate of porcine embryos’ PA from oocytes that underwent HS by increasing their glutathione (GSH) level, reducing reactive oxygen species (ROS) and up-regulating the expression of Sirtuin 1 (SIRT1). It was also found −7 −7 that melatonin (10 mol/L) and the combination of resveratrol (2.0 μmol/L) plus melatonin (10 mol/L) exhibited more potent effects than resveratrol alone regarding their protective activities on oocyte maturation under HS. Conclusions: This study compared the efficiencies of resveratrol, melatonin and their combination for protecting porcine oocytes from heat stress. The mechanisms are attributed to the fact that each treatment may have different ability to regulate the synthesis of steroid hormones and the expression of mature related genes. Keywords: Combination, Maturation Melatonin, Oocyte, Porcine, Resveratrol Background secretion by luteal cells and increased the follicle-stimu- Although modern cooling systems are used for preserving lating hormone (FSH) [4]. The disruption of steroid hor- porcine, their fertility remains low. A critical issue for their mone secretion was caused by the abnormal expression of fertility failure is the poor quality of oocyte maturation. HS their synthetic genes in ovaries under heat stress [5]. Ozawa disrupts the synthesis of the steroid hormone involved in et al. observed that heat stress during the follicular recruit- the regulating mechanism of oocyte maturation. Roth et al. ment phase suppressed the subsequent growth to ovulation, found that heat stress retarded the growth of follicles [1] accompanied by decreased LH receptor level and estradiol and reduced steroid hormone production, which is related synthesis activity in the follicles [3]. Shimizu et al. reported to the low fertility of animals [1–3]. Wolfenson et al. re- that heat stress strongly inhibited gonadotropin receptor ported that HS caused relatively low plasma concentration levels and aromatase activities in granulosa cells. The estra- of the luteinizing hormone (LH), reduced progesterone diol levels in the follicular fluid of early antral, antral and preovulatory follicles were also reduced [6]. HS had nega- * Correspondence: gshliu@cau.edu.cn tive effects on oocyte maturation via down-regulation of Equal contributors the gene expression in steroid hormone synthesis or their National Engineering Laboratory for Animal Breeding, Key Laboratory of receptors. The disruption of the levels of steroid hormones Animal Genetics and Breeding of the Ministry of Agriculture, Beijing Key Laboratory for Animal Genetic Improvement, College of Animal Science and caused the mature failure of in vitro cultured oocytes. Technology, China Agricultural University, Beijing 100193, China Oxidative stress is another important factor that impedes Full list of author information is available at the end of the article the cytoplasmic and nuclear maturation of porcine oocyte © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 2 of 10 under HS. Nabenishi et al. reported heat stress on porcine systematically investigated. In addition, its efficiency against oocyte had an adverse effect on their developmental com- HS will be compared with melatonin, another potent anti- petence by increasing GSH content and inhibiting the pro- oxidant, and the combination of melatonin with resveratrol. duction of oocyte ROS [7]. Similar results were observed by Ozawa et al., who found that heat stress at the zygote stage Methods reduced the developmental ability of mouse embryos via Chemicals physiological changes in the maternal environment. These All chemicals used in this study were purchased from changes thus led to an increase in intracellular oxidative Sigma-Aldrich Co (Alcobendas, Madrid, Spain) unless stress on the embryo [8]. These phenomena also occurred otherwise indicated. in bovine oocytes, as reported by Sakatani et al. [9]. An increasing oxidative stress caused by HS in the oviduct was Animal studies possibly involved in heat stress-induced early embryonic All animal studies were conducted in accordance with the death [10]. HS retarded the nuclear maturation of oocytes, requirement of the Institutional Animal Care Committee resulting in the poor quality of oocytes, and thus reduced and have been approved by the Ethics Committee of the the potency of their development. Most ovine oocytes that China Agriculture University. matured under heat-shock conditions remained at the ger- minal vesicle breakdown (GVBD) stage, and they showed In vitro maturation an aberrant chromatin configuration in the research of Porcine ovaries were collected from the local abattoir (The Gharibzadeh [11]. Cherng et al. found that HS caused cer- Fifth Meat Co, Beijing) and immediately transported in tain unfavorable changes in the nucleus and cytoskeleton in saline (30 ºC) to the laboratory within 4 h. COCs (cu- porcine oocytes, which might be associated with reducing mulus-oocyte complexes) were aspirated from the folli- development under the hyperthermic condition and pos- cles (3–8 mm in diameter) using a 10 mL syringe fixed sibly with the low pregnancy rates in domestic species with an 18-gauge needle. Four or more layers of compact during hot seasons [12]. Payaton et al. observed that heat cumulus cells were used for in vitro maturation after stress of oocytes during the GV-stage reduced the pro- washing three times in HEPES-buffered Tyrode’s medium portion of oocytes that progressed to metaphase II after (TLH) containing 0.3 % (w/v) bovine serum albumin in vitro maturation (IVM). Heat treatment for 6 h de- (BSA). The COCs were matured (80–90 COCs/500 μL) in creased the proportion of 8- to 16-cell embryos, whereas the IVM medium (which consisted of TCM199 plus 0.3 % heat treatment for 12 h reduced blastocyst development (w/v) BSA containing 10 IU/mL equine chorionic gonado- [13]. Wang et al. found that spindle assembling was tropin and 10 IU/mL human chorionic gonadotropin, affected and MAD2 was activated in some of the mouse 0.57 mmol/L cysteine and 10 ng/mL epidermal growth oocytes that matured at 40.7 °C [14]. factor) at 38.5°Cin 5 % CO . Resveratrol (3,4,5-trihydroxy-trans-stilbene), an antifun- gal molecule of the stilbene family, is produced in a variety Assessment of polar body rate of plant species, particularly in grapes, in response to To assess the polar body of the metaphase II (MII) oocyte, pathogen attack or under stressful conditions such as UV the samples were collected after 44 h of maturation. The radiation [15]. Resveratrol is also a strong antioxidant, cumulus cells were removed by gently pipetting in the PBS- maintaining the levels of antioxidant enzymes such as PVA (0.1 % PVA) medium containing 0.1 % (w/v) hyaluron- glutathione peroxidase (GPx), superoxide dismutase idase. The oocytes were stained with Hoechst 33342 for (SOD), and catalase (CAT) [16, 17] and improving the 10 min. Then, the samples were rinsed with 0.1 % PVA- distribution and function of mitochondria [18]. All these DPBS medium three times, and were mounted on a clean are critical for oocyte maturation. As a phytoestrogen, glass slide, covered with a coverslip, and examined with an resveratrol has an equivocal role in regulating the level of inverted microscope (Nikon Corporation) equipped with estrogen by binding to estrogen receptors (ERs) and evok- epifluorescence. ing biological effects parallel to those exerted by endogen- ous and synthetic estrogens [19]. It functions as estrogen Parthenogenetic activation (PA) receptor agonist in different test systems [20]. Resveratrol After 44 h of maturation, cumulus cells were removed by can enhance the progesterone secretion and expression of gently pipetting in the PBS-PVA (0.1 % PVA) medium luteinization-related genes in the ovary [21]. Many studies containing 0.1 % (w/v) hyaluronidase. Denuded MII oocytes have shown that a supplement with resveratrol improves were washed 2–3 times in activation medium (0.28 mol/L oocyte maturation and the subsequent development in mannitol; 0.01 % polyvinyl alcohol; 0.05 mmol/L HEPES; mice [22], bovines [18, 23], goats [24] and porcines [25]. 0.1 mmol/L CaCl ·2H O and 0.1 mmol/L MgCl )before 2 2 2 In the current study, the potential effect of resveratrol on in PA. For activation, an electrical pulse (1.3 KV/cm, 80 μs) vitro porcine oocyte maturation under HS will be generated by a BTX Electro-Cell Manipulator 2001 (BTX, Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 3 of 10 San Diego, CA, USA) was applied to oocytes. After being apoptotic nuclei (by TUNEL assay) and the total numbers washed three times with PZM-3 (containing 7.5 μg/mL of nuclei were determined from optical images. The apop- cytochalasin B(CB) and 10 μg/mL cyclohexane (CHX)), the totic rate was calculated as follows: apoptotic rate = (num- oocytes were put into PZM-3 (containing 7.5 μg/mL CB ber of TUNEL-positive nuclei/total number of nuclei) × and 10 μg/mL CHX, 20 to 30 oocytes/60 μL) medium for 100 %. 4handthenwashed3timeswithPZM-3.Then, they were cultured for 7 d to evaluate their developmental compe- RNA isolation and quantitative real-time polymerase chain tence (cleavage rate at d 3 and blastocyst rate at d 7). reaction Fresh immature COCs were collected after HS, washed Measurement of intracellular ROS and GSH levels twice with DPBS solution and stored at −80 °C until the The IVM oocytes at the MII stage were sampled 44 h after RNA was extracted. The total RNA was extracted using IVM in a medium with different supplements (resveratrol, TRIzol reagent (Invitrogen Inc.,Carlsbad,CA,USA),quan- melatonin, and their combination) or without to determine tified by measuring the absorbance at 260 nm and stored at their intracellular ROS and GSH levels, as described by −80 °C until use. The levels of relevant mRNA, including Wang et al. [23]. Briefly, 2070-dichlorodihydrofluorescein the products of antioxidant-related genes, apoptosis-related diacetate (H2DCFDA; Beyotime Institute of Biotechnol- genes and maturation-related genes, were determined by ogy, Jiangsu, China) and 4-chloromethyl-6,8-difluoro-7- quantitative real-time polymerase chain reaction (RT-PCR) hydroxycoumarin (Cell Tracker Blue CMF2HC Molecular usingaOneStepSYBRPrime Script RT-PCR Kit(TaKaRa Probes; Beyotime Institute of Biotechnology) were used to Bio Inc., Tokyo, Japan) in a Light Cycler instrument (Roche, detect intracellular ROS as green fluorescence and the Mannheim, Germany). The levels of accumulated fluores- GSH level as blue fluorescence, respectively. A total of 25– cence were analyzed using the second derivative method 30 oocytes from each treatment group were incubated (in after the melting-curve analysis was complete. Then, the the dark) for 30 min in DPBS-PVA containing 10 mmol/L expression levels of the target genes were normalized to the H2DCFDA or 10 mmol/L Cell Tracker Blue. After incuba- expression level of actin in each sample. The primer pairs tion, the oocytes were washed with DPBS-PVA and placed for the analyzed mRNAs are listed in Table 1. in 10 μL droplets. Then, the fluorescence was observed using an epifluorescence microscope (TE300; Nikon) with Experimental procedures UV filters (460 nm for ROS and 370 nm for GSH). The All experiments were conducted in a heat-stress model fluorescent images were saved as graphic files in TIFF (42 °C, 20–24 h IVM) chosen from different HS strat- format. The fluorescence intensities of the oocytes were egies, which can significantly reduce the polar body rate analyzed using Image J software (version 1.40; National of oocytes and the blastocyte rate of porcine PA embryos Institutes of Health, Bethesda, MD) and normalized to that [26]. Resveratrol (0.5, 2.0, 5.0, and 10.0 μmol/L), melatonin −7 of the control. The experiment was replicated three times. (10 mol/L), which was set according to the previous −7 study [26], and the combination of melatonin (10 mol/ Apoptosis assays (TUNEL) and total cell counts of blastocyst L) and resveratrol (2.0 μmol/L) were added to the Apoptosis was detected by terminal deoxynucleotidyl transferase-mediated d-UTP nick end-labeling (TUNEL) Table 1 Primers used in this study assay. Briefly, 7-d-old embryos were washed three times in Gene Primer sequence(5’-3’) T (°C) Size,bp DPBS-PVP (DPBS supplemented with 0.1 % polyvinylpyr- β-actin Forward: GTGGACATCAGGAAGGACCTCTA 60.0 131 rolidone) and fixed in 4 % (v/v) paraformaldehyde solution Reverse: ATGATCTTGATCTTCATGGTGCT for 1 h at room temperature. Membranes were made HSP70 Forward: TTCGACGTGTCCATCCTGACG 60.0 169 permeable in 0.1 % Triton X-100 in 0.1 % citrate solution Reverse: TCACCGCCCGCTTGTTCTGG for 1 h at room temperature. Fixed embryos were incubated Sphk1 Forward: CCAGGTGCACCCAAACTACT 60.0 92 in TUNEL reaction medium (In Situ Cell Death Detection Reverse: GAGGCTTCTGGCTGAGTGAG Kit, Fluorescein; Roche, Mannheim, Germany) for 1 h SOD1 Forward: TCCATGTCCATCAGTTTGGA 60.0 131 Reverse: AGTCACATTGGCCCAGGTCTC at 38.5°Cin the dark.Therefore,the broken DNAends of the embryonic cells were labeled with TdT and CYP11A Forward:TGGTGACAATGGCTGGATTAACCT 60.0 376 Reverse: GACGAAGTCCTGAGACACTGTGT fluorescein-dUTP. After the reaction stopped, the embryos were washed in DPBS-PVA and mounted on glass slides CYP19 Forward: GTCGTGGACTTCGTCATG 60.0 257 Reverse: AGTGTGACCAAGATGACCTT with DAKO Fluorescent Mounting Medium (S3023, Dako SIRT1 Forward: TTGATCTTCTCATTGTTATTGGGTC 60.0 62 North America, Carpinteria, CA, USA) containing Hoechst Reverse: ACTTGGAATTAGTGCTACTGGTCTTA 33342 for total cell counts. Whole-mount embryos were Akt2 Forward: AAAGTCATCCTGGTGCG 60.0 136 examined under an epifluorescence microscope (Nikon) by Reverse: GGGTGCCTGGTGTTCTG TUNEL assay and Hoechst staining. The numbers of Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 4 of 10 maturation solution. The intracellular levels of ROS and 0.05), and there were no obvious changes in the 0.5 and GSH, the total number of blastocysts, the apoptosis cell 5.0 μmol/L resveratrol-treated groups (61.82 ± 1.41 % and rate in blastocysts, and the expression of genes associated 64.01 ± 0.76 %; P > 0.05). In contrast, the 10.0 μmol/L res- with oxidation apoptosis maturation were tested to com- veratrol group had the lowest polar body rate (53.95 ± pare the efficiency of resveratrol and melatonin and their 0.01 %; Fig. 1a). combination to protect porcine oocyte from HS. After PA, the cleavage rate of embryos from oocytes with heat treatment was significantly lower than that of Statistics analysis embryos from the non-HS group (76.78 ± 1.49 % vs 82.64 Data are expressed as the mean ± S.E.M. Statistical ana- ±3.18 %; P < 0.05). The cleavage rate of resveratrol-treated lyses were performed using univariate analysis of variance groups failed to increase (68.88 ± 1.01 %, 73.92 ± 8.38 %, (ANOVA) with the aid of SPSS 19.0 statistical software, and 72.77 ± 6.86; P > 0.05; Fig. 1b). On the other hand, followed by Student’s t-test. P < 0.05 was considered sig- heat stress significantly reduced the blastocyst rate of em- nificant, and P < 0.01 was considered highly significant. bryos after PA (18.28 ± 0.66 % vs 43.48 ± 3.07 %; P < 0.05), and the supplement with 2.0, 5.0, and 10.0 μmol/L resver- Results atrol enhanced the blastocyst rate significantly (28.27 ± Effect of resveratrol on maturation of porcine oocytes under 1.02 %, 24.75 ± 1.52 %, and 23.25 ± 1.50 %; P < 0.05; heat stress Fig. 1c). A total of 1098 oocytes (more than six replications) under- went maturation with or without heat treatment with dif- Effects of resveratrol, melatonin and their combination on ferent concentrations of resveratrol (0.5, 2.0, 5.0, and maturation of porcine oocyte under heat stress −7 10.0 μmol/L). After maturation (IVM 44 h), the polar Melatonin (10 mol/L), resveratrol (2.0 μmol/L) and their body rates were tested. The results showed that the polar combination were selected to compare their ability against body rate of oocytes that underwent heat stress (HS heat stress. The results showed that the polar body rates group) was significantly lower than that of the non-HS of the melatonin group (M-HS) and the combination group (67.32 ± 0.30 % and 61.62 ± 1.39 %, respectively; group (M + R-HS) were significantly higher than those of P < 0.05). The polar body rate at the 2.0 μmol/L resvera- the non-HS group (72.37 ± 1.44 % and 75.57 ± 1.17 % vs trol (R) group was significantly higher (70.62 ± 0.87, P < 67.47 ± 1.44 %; P < 0.05). The polar body rate of the Fig. 1 Effect of different concentrations of resveratrol on the PB1 rate of porcine oocyte and development competence after PA. a Effect of different concentrations of resveratrol on the PB rate. b Effect of different concentrations of resveratrol on the cleavage rate of porcine PA embryo. c Effect of different concentrations of resveratrol on the blastocyst rate of porcine PA embryo. d Blastocyst from non-heat stress, heat stress and resveratrol (2.0 μmol/L). bar = 100 μm. non-HS: non-heat stress; HS: heat stress; R:resvertrol Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 5 of 10 resveratrol group (R-HS) was significantly higher than that than that in heat stress group (0.1118 ± 0.0129 pixels/oo- of the HS group (68.53 ± 0.75 % vs 59.08 ± 0.31 %; P < cytes vs 0.1706 ± 0.0087 pixels/oocytes; P < 0.05). These 0.05). The data indicated that resveratrol, melatonin and data indicated that all the treatments of resveratrol, their combination could improve the polar body rate, melatonin and their combination could help to relieve which was reduced by heat stress, and the effects of mela- oocytes from heat stress. The effect of either melatonin tonin and the combination on the polar body rate were or resveratrol was significantly higher than their com- significantly higher than those of resveratrol alone bination (Fig. 2c). (Fig. 2a). The intracellular levels of GSH in the oocytes in the Comparison of different treatments on the equality of PA melatonin and resveratrol groups were significantly higher embryo than those in the non-HS group (0.3262 ± 0.0071 and After PA, the cleavage rates of embryos from oocytes sup- 0.3302 ± 0.0076 pixels/oocytes vs 0.2837 ± 0.0069 pixels/ plemented with melatonin, resveratrol and their combin- oocytes, respectively; P < 0.05). The GSH level of the oo- ation had no significant changes compared with the HS cytes in the combination group was lower than the GSH group (76.11 ± 1.58 %, 74.57 ± 2.32 %, and 72.69 ± 2.81 % vs level of those in melatonin or resveratrol alone groups; 74.75 ± 1.04 %, respectively; P > 0.05). The cleavage rates however, it was still significantly higher than that in the were significantly lower than those of embryos from the heat stress group (0.2975 ± 0.0079 pixels/oocytes vs 0.1543 non-HS group (91.67 ± 1.31 %, P < 0.05). However, heat ± 0.0062 pixels/oocytes; P < 0.05) and similar to the level of stress significantly reduced the blastocyst rate of embryos the non-HS group (Fig. 2b). Consistent with this finding, after PA (20.51 ± 0.58 % vs 32.77 ± 2.33 %; P < 0.05), and the ROS level was significantly lower in the melatonin- and the supplementations of melatonin, resveratrol and their resveratrol-treated samples than that in non-HS groups combination raised the blastocyst rate significantly (0.0728 ± 0.0124 and 0.0715 ± 0.0067 pixels/oocytes vs 0.13 (26.03 ± 1.63 %, 25.32 ± 1.33 %, and 28.66 ± 0.94 %, re- 36 ± 0.0091 pixels/oocytes, respectively; P < 0.05). The ROS spectively; P < 0.05). The blastocyst rate in the combin- level in the combination group was also significantly lower ation group was not significantly different from that of Fig. 2 Effect of different supplements on the maturation of porcine oocytes under HS. a Effect of different supplements on the PB1 rate of porcine oocyte. b Effect of different supplements on the GSH level. c Effect of different supplements on the ROS level. d Effect of different supplements on the ROS and GSH levels. non-HS: non-heat stress; HS: heat stress; M-HS: supplement melatonin under heat stress; R-HS: supplement resveratrol under heat stress; M + R-HS: under heat stress melatonin and resveratrol under heat stress Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 6 of 10 the non-HS group (P > 0.05). The combination of mela- Different supplements on the expression of genes in COCs tonin and resveratrol was the most effective treatment The level of HSP70 gene expressed in the COCs was sig- regarding the increasing blastocyst rate under the HS nificantly higher in the heat-treatment group than that in (Fig. 3a). the non-HS group (P < 0.05). Melatonin, resveratrol and Heat stress significantly reduced the total cell number their combination did not significantly affect the HSP70 of blastocysts compared to the non-HS group (41.96 ± gene expression when compared with HS group (P > 0.05; 3.17 vs 53.44 ± 2.65; P < 0.05), whereas the melatonin Fig. 4a). Regarding antioxidant-related gene SOD1 and and combination groups preserved the total cell num- apoptosis-related gene SPKH1, heat stress significantly berata similarlevelto thenon-HSgroup (52.90±3.84 enhanced their expressions (P < 0.05), whereas treatments and 55.26 ± 3.91; P < 0.05). The total cell number of with melatonin, resveratrol or their combination did not blastocysts in the resveratrol group (49.9 ± 3.56) was modify the expression levels of these genes, which were not significantly different from that of the non-HS up-regulated by HS (P > 0.05; Fig. 4b). Melatonin, resvera- group or the heat stress group (P >0.05; Fig. 3b). How- trol and their combination significantly raised the expres- ever, the heat stress group had a significantly higher sion of SIRT1 compared with the non-HS and HS group apoptosis cell number than the non-HS group (2.21 ± (P < 0.05; Fig. 4c). As to the genes involved in steroidogen- 0.35 vs 1.31 ± 0.11; P < 0.05). The melatonin, resveratrol esis, CYP11A and CYP19 were reported to be expressed in and combination groups significantly reduced apoptotic cumulus cells and take part in the synthesis of progesterone cells (1.46 ± 0.22, 1.40 ± 0.31, and 1.46 ± 0.22, respect- and estrogen, respectively [27, 28]. Heat stress reduced the ively; P < 0.05; Fig. 3c). The apoptotic cell rate showed a expression of CYP11A. The melatonin and combination similar tendency to the apoptotic cells in different groups showed strong abilities in up-regulating the expres- treated groups (6.00 ± 1.26 % vs 2.88 ± 0.38 %, 2.93 ± sion of CYP11A to the level of the non-HS group, whereas 0.41 %, 3.48 ± 1.07 % and 3.08 ± 0.78 %, respectively; resveratrol had no significant effect in up-regulating the P < 0.05;Fig. 3d). expression of this gene (P > 0.05). All treatments had no Fig. 3 Effect of different supplements on the quality of PA embryo from oocyte under HS. a Effect of different supplements on the development competence of PA embryo from oocyte under HS. b Effect of different supplements on the cell number of blastocysts. c Effect of different supplements on the apoptotic cell number of blastocysts. d Effect of different supplements on the apoptotic cell rate of blastocysts. non-HS: non-heat stress; HS: heat stress; M-HS: supplement melatonin under heat stress; R-HS: supplement resveratrol under heat stress; M + R-HS: under heat stress melatonin and resveratrol under heat stress Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 7 of 10 Fig. 4 Effect of different supplements on the expression of genes. a Effect of different supplements on the expression of HSP70. b Effect of different supplements on the expression of genes associated with antioxidants and apoptosis. c Effect of different supplements on the expression of SIRT1. d Effect of different supplements on the expression of genes associated with the synthesis of steroid hormones. non-HS: non-heat stress; HS: heat stress; M-HS: supplement melatonin under heat stress; R-HS: supplement resveratrol under heat stress; M + R-HS: under heat stress melatonin and resveratrol under heat stress significant effects on the expression of CYP19 (P > 0.05; [25]. These authors reported that resveratrol failed to in- Fig. 4d). crease the polar body rate of porcine oocytes in the normal case. However, our data showed that resveratrol (2.0 μmol/ Discussion L) improved nuclear maturation, which indicated resvera- In the current study, we found that the polar body rate, an trol had a direct effect for protecting porcine oocytes from index of the nucleus maturation of porcine oocytes, was HS by reducing the high level of ROS and helping them retarded by heat stress. Resveratrol (2.0 μmol/L) relieved produce more GSH. In a word, it provided a proper envir- the adverse effect and increased the proportion of oocytes onment for nuclear maturation. We also found that resver- that had matured into the MII stage (Fig. 1a). This effect of atrol (2.0 μmol/L) enhanced the expression of SIRT1 resveratrol may attribute its ability to be an antioxidant. (Fig. 4c), which had been observed in cows [23] and mice Resveratrol has a strong capacity to reduce oxidant damage [22]. SIRT1 was reported to associate with regulating au- [29]. It improves the maturation environment by alleviating tophagy and mitochondrial function in cells upon oxidative the high level of ROS in heat-treated porcine oocytes. Our stress [30]. Resveratrol was found to improve mitochondrial results confirmed that resveratrol (2.0 μmol/L) not only function by activating SIRT1 [31, 32]. This finding was con- scavenged ROS but also improved the intracellular GSH firmed in the current study; i.e., the expression of SIRT1 level of oocytes to further fight oxidative stress (Fig. 2b-c). was up-regulated by resveratrol under HS. Our data indi- This finding was consistent with the result of Kwak et al. cated that resveratrol (2.0 μmol/L) promoted the nucleus Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 8 of 10 maturation of porcine oocytes by reducing the oxidant oxidase to ease some neurodegenerative diseases [38]. In stress caused by heat, and it ensured cytoplasm maturation the current study, we observed that melatonin was more by improving the function of mitochondria through SIRT1. potent than resveratrol in increasing the polar body rate Resveratrol (2.0 μmol/L) promoted the development under the condition of HS (Fig. 2a). This finding was con- competence of embryos PA from oocytes that underwent sistent with the observations of others [36, 37]. The poten- HS with a higher blastocyst rate (Fig. 1c) and quality tial mechanisms may contribute to melatonin’sfavorable (Fig. 3b, c, d), which was also reported in bovines [23], distribution in both the lipid and water phases [39] and its goats [24], mice [22], and porcines [25]. Resveratrol pre- cascade reaction with free radicals [40]. The significantly vented cells from apoptosis (Fig. 3c-d). Kong et al. reported weaker ability of resveratrol in comparison to melatonin that resveratrol delayed oocyte nest breakdown and inhib- to up-regulate the expression of CYP11A under heat stress ited both the primordial-to-developing follicle transition could be another reason (Fig. 4d). As we all know, mela- and apoptosis by decreasing the activation of Foxo3a, Bim, tonin is a hormone that can be synthesized in mammals, and p27KIP1 [33]. Bucci et al. observed that resveratrol and its receptors are found in many organs, tissues, and modulated the porcine oocyte apoptotic process caused by cells, such as oocyte [41]. Melatonin functions through its cryopreservation-induced damage [34].Notably,resveratrol receptors, for example, promoting bovine embryo devel- didn’t show dose effect. The 2.0 μmol/L was the most effi- opment in vitro by MT1 [32]. By contrast, resveratrol is cient concentration that protected the porcine oocyte from merely a type of phytohormone without a receptor in HS during maturation. Resveratrol of other concentrations animals. We also observed the synergistic effect of mela- showed little or even an adverse effect. The same results tonin and resveratrol in terms of their protective effects were observed by Wang et al.[23]. They found that substan- on in vitro porcine oocyte maturation under HS. However, tially high concentrations of resveratrol might have a nega- similarly to the melatonin and resveratrol groups, the tive effect on bovine oocyte maturation, which might be combination showed no significant improvement in the caused by the competitive inhibition of the activities of cleavage rate (Fig. 3a). It increased the blastocyst rate, the various phosphodiesterases, resulting in an increase in the endpoint for the in vitro development of embryos, under concentration of cytosolic cAMP. By contrast, 10.0 μmol/L HS at the greatest extent compared with melatonin and resveratrol failed to regulate the synthesis of steroid resveratrol alone (Fig. 3a), showing no significant differ- hormones, ultimately lead to retarding oocyte maturation ence from the non-HS group. This may have been caused [23, 35]. by the right ability combination to balance the ROS and There were few studies to compare the efficiency of mela- GSH to the levels of the non-HS group, as shown in tonin and resveratrol on the oocyte maturation under the Fig. 2b-c. As we all know, ROS takes part in some physio- in vitro condition. Ebly et al. showed that melatonin was logical pathway, such as activating the cascade signal in more potent than resveratrol in promoting the expression cells [42]. Therefore, a proper level of ROS was needed. and activity of GSH and glutathione peroxidase in liver, The large rate of GSH/ROS when supplement melatonin whereas in the activation of liver catalase, resveratrol was or resveratrol alone may have caused the final failure to stronger than melatonin [36]. López et al. [37] compared increase the blastocyst rate to the level of the non-HS the effect of melatonin and other antioxidants in reducing group, whereas the combination group achieved it. These DNA damage. They found that 100 μmol/L resveratrol results provide valuable information regarding how to use could reduce 78 ± 4 % 8-OH-dG (an indicator of cell DNA well-known antioxidants to protect oocytes from oxidative damage), but the IC50 (half inhibitory concentration) of stress under unfavorable conditions, including the HS and resveratrol was 10.9 ± 0.3 μmol/L, which is three times in vitro maturation. It seems that the different maturation higher than that of melatonin. They also found that mela- stages of oocytes require different antioxidant strategies. tonin could eliminate the oxidation damage produced by For example, in certain maturation stages, melatonin or low doses of resveratrol, and supplementation with mela- resveratrol alone provides better protection, and in other tonin and resveratrol together did not show a synergistic stages, their combination is more suitable. These will be effect on DNA protection. Our results also showed that our future projects of investigation. their combination, despite significantly reducing the level of ROS and increasing the level of GSH compared with the Conclusions heat stress group, was significant weaker in changing the Resveratrol (2.0 μmol/L) protected porcine oocyte mat- level of ROS and GSH than supplementation with mela- uration in vitro from heat stress (IVM 20–24 h, 42 °C) tonin or resveratrol alone (Fig. 2b-c). by significantly eliminating ROS, increasing GSH, and Melatonin can work synergistically with vitamin C [37]. up-regulating the expression of SIRT1. Comparatively, −7 Other research showed that melatonin can strengthen the melatonin (10 mol/L) and the combination were more nerve protective effect of resveratrol by inhibiting protease potent in alleviating the adverse effects of HS on the ubiquitin-proteasome, which can promote hemoglobin polar body rate than was resveratrol alone. With the Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 9 of 10 combined treatment, the polar body rate was even higher 10. MATSUZUKA T, OZAWA M, NAKAMURA A, USHITANI A, HIRABAYASHI M, KANAI Y. Effects of heat stress on the redox status in the oviduct and early than that of the controls. Melatonin, resveratrol and their embryonic development in mice. J Reprod Dev. 2005;51:281–7. combination failed to improve the cleavage rate of the PA 11. Gharibzadeh Z, Riasi A, Ostadhosseini S, Hosseini SM, Hajian M, Nasr- embryo, but they raised the blastocyst rate compared to Esfahani MH. Effects of heat shock during the early stage of oocyte maturation on the meiotic progression, subsequent embryonic the group under HS, and the combination group had the development and gene expression in ovine. Zygote. 2015;23:573–82. strongest ability in this respect. Melatonin and the com- 12. Ju JC, Tseng JK. Nuclear and cytoskeletal alterations of in vitro matured bination increased the total cell number of blastocysts to a porcine oocytes under hyperthermia. Mol Reprod Dev. 2004;68:125–33. 13. Payton RR, Romar R, Coy P, Saxton AM, Lawrence JL, Edwards JL. higher level than resveratrol did, and they all effectively Susceptibility of bovine germinal vesicle-stage oocytes from antral follicles reduced apoptosis under HS. Generally, the combination to direct effects of heat stress in vitro. Biol Reprod. 2004;71:1303–8. was stronger than melatonin in the efficiency of alleviating 14. Wang J, Sui H, Miao D, Liu N, Zhou P, Ge L, et al. Effects of heat stress during in vitro maturation on cytoplasmic versus nuclear components of the adverse effect of heat stress on porcine oocyte, and mouse oocytes. Reproduction. 2009;137:181–9. melatonin was stronger than resveratrol. 15. Tellone E, Galtieri A, Russo A, Giardina B, Ficarra S. Resveratrol: A Focus on Several Neurodegenerative Diseases. Oxid Med Cell Longev. 2015;2015:1–14. Acknowledgements 16. Yen G, Duh P, Lin C. Effects of resveratrol and 4-hexylresorcinol on This research was supported by programs for the 973 National Basic hydrogen peroxide-induced oxidative DNA damage in human lymphocytes. Research Program of China (2014CB138505) and the Open Foundation of Free Radical Res. 2003;37:509–14. State Key Laboratory of Animal Nutrition (2004DA115184F1415). 17. Rege SD, Kumar S, Wilson DN, Tamura L, Geetha T, Mathews ST, et al. Resveratrol Protects the Brain of Obese Mice from Oxidative Damage. Oxid Authors’ contributions Med Cell Longev. 2013;2013:419092. YL carried out the experiment (design), data interpretation and manuscript 18. Takeo S, Sato D, Kimura K, Monji Y, Kuwayama T, Kawahara-Miki R, et al. writing. JW and ZZZ participated in the culture of oocytes and embryos. Resveratrol improves the mitochondrial function and fertilization outcome They also did some manuscript writing. JYY, FW and XZT participated in the of bovine oocytes. J Reprod Dev. 2014;60:92–9. experiment design. JW, ZZZ, and CJH participated in the molecular genetic 19. Henry LA, Witt DM. Effects of neonatal resveratrol exposure on adult male and studies. All authors contributed to the oocyte collection. All authors read and female reproductive physiology and behavior. Dev Neurosci. 2005;28:186–95. approved the final manuscript. 20. Gehm BD, McAndrews JM, Chien P, Jameson JL. Resveratrol, a polyphenolic compound found in grapes and wine, is an agonist for the estrogen Competing interests receptor. Proc Natl Acad Sci U S A. 1997;94:14138–43. The authors declare that they have no competing interests. 21. Morita Y, Wada-Hiraike O, Yano T, Shirane A,HiranoM,Hiraike H, et al.Resveratrol promotes expression of SIRT1 and StAR in rat ovarian granulosa cells: an Author details 1 implicative role of SIRT1 in the ovary. Reprod Biol Endocrinol. 2012;10:14–30. National Engineering Laboratory for Animal Breeding, Key Laboratory of 22. Liu Y, He X, Huang X, Ding L, Xu L, Shen Y, et al. Resveratrol protects mouse Animal Genetics and Breeding of the Ministry of Agriculture, Beijing Key oocytes from methylglyoxal-induced oxidative damage. PLoS One. 2013;8, e77960. Laboratory for Animal Genetic Improvement, College of Animal Science and 2 23. Wang F, Tian X, Zhang L, He C, Ji P, Li Y, et al. Beneficial effect of resveratrol Technology, China Agricultural University, Beijing 100193, China. College of on bovine oocyte maturation and subsequent embryonic development Animal Science and Technology, Jilin Agricultural University, Changchun, after in vitro fertilization. Fertil Steril. 2014;101:577–86. Jilin, China. 24. Mukherjee A, Malik H, Saha AP, Dubey A, Singhal DK, Boateng S, et al. Resveratrol treatment during goat oocytes maturation enhances Received: 12 January 2016 Accepted: 19 May 2016 developmental competence of parthenogenetic and hand-made cloned blastocysts by modulating intracellular glutathione level and embryonic gene expression. J Assist Reprod Gen. 2014;31:229–39. References 25. Kwak S, Cheong S, Jeon Y, Lee E, Choi K, Jeung E, et al. The effects of 1. Roth Z, Meidan R, Shaham-Albalancy A, Braw-Tal R, Wolfenson D. Delayed resveratrol on porcine oocyte in vitro maturation and subsequent effect of heat stress on steroid production in medium-sized and embryonic development after parthenogenetic activation and in vitro preovulatory bovine follicles. Reproduction. 2001;121:745–51. fertilization. Theriogenology. 2012;78:86–101. 2. Wolfenson D, Lew BJ, Thatcher WW, Graber Y, Meidan R. Seasonal and 26. Li Y, Zhang Z, He C, Zhu K, Xu Z, Ma T, et al. Melatonin protects porcine acute heat stress effects on steroid production by dominant follicles in oocyte in vitro maturation from heat stress. J Pineal Res. 2015;59(3):365–75. cows. Anim Reprod Sci. 1997;47:9–19. 27. Millier SG, Whitelaw PF, Smyth CD. Follicular oestrogen synthesis: the ‘two- 3. Ozawa M, Tabayashi D, Latief TA, Shimizu T, Oshima I, Kanai Y. Alterations in cell, two-gonadotrophin’model revisited. Mol Cell Endocrinol. 1994;100:51–4. follicular dynamics and steroidogenic abilities induced by heat stress during 28. Drummond AE. The role of steroids in follicular growth. Reprod Biol follicular recruitment in goats. Reproduction. 2005;129:621–30. Endocrin. 2006;4:1435–41. 4. Wolfenson D, Roth Z, Meidan R. Impaired reproduction in heat-stressed 29. Liu FC, Tsai HI, Yu HP. Organ-Protective Effects of Red Wine Extract, cattle: basic and applied aspects. Anim Reprod Sci. 2000;60:535–47. Resveratrol, in Oxidative Stress-Mediated Reperfusion Injury. Oxid Med Cell 5. Argov N, Moallem U, Sklan D. Summer heat stress alters the mRNA Longev. 2015;2015:568634. expression of selective-uptake and endocytotic receptors in bovine ovarian 30. Ou X, Lee MR, Huang X, Messina GS, Broxmeyer HE. SIRT1 Positively cells. Theriogenology. 2005;64:1475–89. Regulates Autophagy and Mitochondria Function in Embryonic Stem Cells 6. Shimizu T, Ohshima I, Ozawa M, Takahashi S, Tajima A, Shiota M, et al. Heat stress Under Oxidative Stress. Stem Cells. 2014;32:1183–94. diminishes gonadotropin receptor expression and enhances susceptibility to 31. Marie L, Carmen A, Zachary GH, Hamid M, Carles L, Frederic D, et al. apoptosis of rat granulosa cells. Reproduction. 2005;129:463–72. Resveratrol improves mitochondrial function and protects against metabolic 7. Nabenishi H, Ohta H, Nishimoto T, Morita T, Ashizawa K, Tsuzuki Y. The disease by activating SIRT1 and PGC-1alpha. Cell. 2006;127:1109–22. effects of cysteine addition during in vitro maturation on the 32. Xu Y, Nie L, Yin YG, Tang JL, Zhou JY, Li DD, et al. Resveratrol protects against developmental competence, ROS, GSH and apoptosis level of bovine hyperglycemia-induced oxidative damage to mitochondria by activating SIRT1 oocytes exposed to heat stress. Zygote. 2012;20:249–59. in rat mesangial cells. Toxicol Appl Pharmacol. 2011;259:395–401. 8. Ozawa M, Hirabayashi M, Kanai Y. Developmental competence and oxidative state of mouse zygotes heat-stressed maternally or in vitro. 33. Kong X, Fu Y, Xu J, Zhuang X, Chen Z, Luo L. Resveratrol, an effective Reproduction. 2002;124:683–9. regulator of ovarian development and oocyte apoptosis. J Endocrinol Invest. 9. Sakatani M, Kobayashi SI, Takahashi M. Effects of heat shock on in vitro 2011;34:e374–81. development and intracellular oxidative state of bovine preimplantation 34. Bucci D. Effects of resveratrol on vitrified porcine oocytes. Oxid Med Cell embryos. Mol Reprod Dev. 2004;67:77–82. Longev. 2013;48:102. Li et al. Journal of Animal Science and Biotechnology (2016) 7:33 Page 10 of 10 35. Park S, Ahmad F, Philp A, Baar K, Williams T, Luo H, et al. Resveratrol ameliorates aging-related metabolic phenotypes by inhibiting cAMP phosphodiesterases. Cell. 2012;148:421–33. 36. Eybl V, Kotyzova D, Koutensky J. Comparative study of natural antioxidants– curcumin, resveratrol and melatonin–in cadmium-induced oxidative damage in mice. Toxicology. 2006;225:150–6. 37. López Burillo S, Tan DX, Mayo JC, Sainz RM, Manchester LC, Reiter RJ. Melatonin, xanthurenic acid, resveratrol, EGCG, vitamin C and α-lipoic acid differentially reduce oxidative DNA damage induced by Fenton reagents: a study of their individual and synergistic actions. J Pineal Res. 2003;34:269–77. 38. Kwon KJ, Kim JN, Kim MK, Lee J, Ignarro LJ, Kim HJ, et al. Melatonin synergistically increases resveratrol‐induced heme oxygenase‐1 expression through the inhibition of ubiquitin‐dependent proteasome pathway: a possible role in neuroprotection. J Pineal Res. 2011;50:110–23. 39. Karbownik M, Lewinski A, Reiter RJ. Anticarcinogenic actions of melatonin which involve antioxidative processes: comparison with other antioxidants. Int J Biochem Cell B. 2001;33:735–53. 40. Tan DX, Manchester LC, Terron MP, Flores LJ, Reiter RJ. One molecule, many derivatives: A never-ending interaction of melatonin with reactive oxygen and nitrogen species? J Pineal Res. 2007;42:28–42. 41. Sampaio RV, Conceição S, Miranda MS, Sampaio Lde F, Ohashi OM. MT3 melatonin binding site, MT1 and MT2 melatonin receptors are present in oocyte, but only MT1 is present in bovine blastocyst produced in vitro. Reprod Biol Endocrinol. 2012;10:103. 42. Combelles CM, Gupta S, Agarwal A. Could oxidative stress influence the in- vitro maturation of oocytes? Reprod Biomed Online. 2009;18:864–80. Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries � Our selector tool helps you to find the most relevant journal � We provide round the clock customer support � Convenient online submission � Thorough peer review � Inclusion in PubMed and all major indexing services � Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit

Journal

Journal of Animal Science and Biotechnology – Springer Journals

Published: Jun 3, 2016

There are no references for this article.