Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

RETRACTED ARTICLE: Hsa_circ_0005379 regulates malignant behavior of oral squamous cell carcinoma through the EGFR pathway

RETRACTED ARTICLE: Hsa_circ_0005379 regulates malignant behavior of oral squamous cell carcinoma... Background: Oral squamous cell carcinoma (OSCC) is an oral and maxillofacial malignancy with a high incidence worldwide. Accumulating evidence indicates that circular RNAs (circRNAs) play a vital role in modulating tumor development. However, the mechanism of circRNA action in human OSCC remains largely unknown. Methods: By using high-throughput transcriptome sequencing technology, we conducted a comprehensive study of circRNAs in human OSCC. The effect of circRNA hsa_circ_0005379 on OSCC tissues and cell lines was monitored by qRT-PCR, Transwell assay, flow cytometry, and western blot analysis. Xenograft mouse models were used to assess tumor growth and animal survival. Results: We found that circRNA hsa_circ_0005379 expression is significantly lower in OSCC tissue compared to paired non-cancerous matched tissue and is associated with tumor size and differentiation. Overexpression of hsa_circ_0005379 effectively inhibits migration, invasion, and proliferation of OSCC cells in vitro and suppresses OSCC growth in nude mice in vivo. Mechanistic studies revealed that hsa_circ_0005379 may be involved in the regulation of the epidermal growth factor receptor (EGFR) pathway. Furthermore, we found that high expression of hsa_circ_0005379 could significantly enhance the sensitivity of OSCC to the cetuximab drug. Conclusions: Our findings provide evidence that hsa_circ_0005379 regulates OSCC malignancy and may be a new therapeutic target for OSCC treatment. Keywords: Oral squamous cell carcinoma, Circular RNAs, EGFR pathway, Cetuximab, Epithelial–mesenchymal transition Background cancer is even lower. OSCC has become a progressively Oral squamous cell carcinoma (OSCC) is an invasive ma- serious global problem. lignant tumor with different degrees of differentiation. The Circular RNAs (circRNAs) are a class of noncoding poor-differentiated OSCC has a tendency to metastasize to RNA molecules that do not have a 5′-end cap or 3′-end early lymph nodes [1]. It accounts for about 3% of the poly (A) tail. Previous reports have shown that circular world’s malignant tumors [2]. Every year, 1.6 million people RNAs are endogenous, stable, abundant, and conserved are diagnosed and 333,000 people die from head and neck RNA molecules that can have cell type- or developmen- squamous cell carcinoma (HNSCC), of which half the tal stage-specific expression patterns in eukaryotic cells cases are OSCC [3]. Moreover, incidence rates of OSCC in [5–7]. Studies have revealed the presence of differentially developing countries are higher than developed countries expressed circular RNA in various tumor tissues, which [2]. The latest academic statistics shows that the five-year are significantly associated with distant metastases, survival rate of patients with OSCC is about 60% [4], TNM staging, and other clinical features [8, 9]. Including while the 5-year survival rate of patients with advanced colon, gastric, and esophageal cancers [10, 11]. Studying features of circRNAs can provide new insights into tumor pathogenesis. However, literature on the expres- * Correspondence: yuehongshen@hotmail.com; hyyang192@hotmail.com sion of circular RNA in oral squamous cell carcinoma Department of Oral and Maxillofacial Surgery, Peking University Shenzhen is limited. Hospital, No. 1120 Lianhua Road, Shenzhen 518001, Guangdong, China Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Su et al. BMC Cancer (2019) 19:400 Page 2 of 13 To investigate the regulatory role of circRNAs in Lipofectamine 3000 (Gibco, New York, USA) was OSCC, high-throughput sequencing was used to screen used for siRNA transfection. All three siRNAs gave differentially expressed circular RNA in paired OSCC identical results. tissues and adjacent normal tissue samples [12]. We found that hsa_circ_0005379 is an OSCC tumor sup- Lentivirus infection and monoclonal cell screening pressor gene associated with tumor size and differenti- The lentiviral plasmid containing GFP and puromycin-re- ation. Upregalation of hsa_circ_0005379 effectively sistant gene was constructed by HanBio Co. Ltd. (Shang- inhibits migration, invasion, proliferation of OSCC cells hai, China). Polybrene/medium mixture with packaged and angiogenesis formation in vitro, and suppresses lentivirus was incubated with SCC25 and CAL27 cells for OSCC growth in nude mice in vivo. We also found that 48 h. After infection, the transduced cells were screened hsa_circ_0005379 may be involved in the regulation of by puromycin (SCC25, 6 μg/ml; CAL27, 10 μg/ml; Qcbio the epidermal growth factor receptor (EGFR) pathway Science & Technologies Co. Ltd. Shanghai, China). The by affecting EGFR expression. Moreover, our study screened cells were diluted and plated into 96-well showed that high expression of hsa_circ_0005379 com- plates to get a single cell per well. Monoclonal cells bined with cetuximab can significantly promote OSCC were verified by qRT-PCR. Fluorescence microscopy cell apoptosis. Taken together, our findings provide was used to observe the expression of GFP in infected evidence that hsa_circ_0005379 regulates cancer and cells. may be a new therapeutic target for OSCC treatment. RNA preparation and qRT-PCR Total RNA was extracted with an RNeasy Mini Kit Methods (QIAGEN, Hilden, Germany). RNA was incubated with Patients and tissue samples 3 U/mg RNase R (Epicenter) for 15 min at 37 °C. For All patient tissue samples were obtained from the Stoma- reverse transcription, 500 ng of RNase R-treated RNA tological Center of Peking University Shenzhen Hospital was reverse transcribed using Prime Script RT Master (Shenzhen, China), between 2016 and 2018. Patients Mix (Takara Bio Inc., Kusatsu, Japan). PCR reactions enrolled in the study was selected to rule out systemic were performed using PCR Master Mix (2×) (Thermo disease and preoperative radiotherapy or chemotherapy. Fisher Scientific, Waltham, MA, USA). Primers used for The histopathological grading of tumors was performed qRT-PCR are listed as follows: according to the 2018 World Health Organization classi- hsa_circ_0005379-F1: GCCCATACCTTTATCCACTC fication criteria for head and neck cancer. The circular hsa_circ_0005379-R1: GTCAACATTCCAGTCTCTTCCT RNA profiling was obtained through high-throughput hsa_circ_0005379-F2: CCTAAGAAGACCACAATGCG sequencing of four pairs of specimens. (Guangzhou Gene hsa_circ_0005379-R2:CCTCCGTAGTAAGGGTTTCG Denovo Biotechnology Co. Ltd., Guangzhou, China). This β-actin-F: AAACTGGAACGGTGAAGGTG study was approved by the Ethics Committee of Peking β-actin-R: AGTGGGGTGGCTTTTAGGAT. University Health Science Center (IRB00001053–08043). CCK-8 assay Tumor cells were seeded into 96-well plates at 2 × 10 Cell culture and transfection cells per well. CCK-8 (Beyotime, Shanghai, China) was HumanOSCCcelllines SCC9,SCC15,SCC25,and CAL27 added at 10 μl/well at different time points and incubated are gifts given by Wuhan University (Wuhan, China). for 1 h. The OD value at 450 nm absorbance was mea- Human oral keratinocyte (HOK) cells were obtained sured. To treat the cells with EGFR drugs, NSC228155 from the cell bank of the Chinese Academy of Sciences was added at the concentration of 29 μg/ml and incubated (Shanghai, China). All cells were cultured in Dulbecco’s for 15 min. Cetuximab was added at the concentration of modified Eagle medium (DMEM; Gibco, New York, 10 μg/ml and incubated for 72 h. USA). Human umbilical vein endothelial cells (HUVEC) and culture medium were bought from Procell Life Science and Technology Company (WuHan, China). 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay All cell lines were cultured at 37 °C incubator with 5% Tumor cells were seeded at 4 × 10 cells/well into 96-well CO . The siRNAs for hsa_circ_0005379 were synthe- plates and grown to logarithmic phase. Then EdU dye, sized by RiboBio Co. Ltd. (Guangzhou, China). The siRNA PBS buffer, Apollo and Hoechst 33342 (Beyotime Biotech- sequences are as follows: nology, Shanghai, China) were used to stain the cells, siRNA-1: 5′-CAAGGAAUGUAUCCUGUCA-3′; respectively. Images were taken randomly under a siRNA-2: 5′-AAGGAUUUGCAAGGAAUGUAU-3′; fluorescence microscopy. The cells were counted using siRNA-3: 5′-GAUUUGCAAGGAAUGUAUCCU-3′. Image J software. Su et al. BMC Cancer (2019) 19:400 Page 3 of 13 Co-cultivation experiment washed with PBS, and cell migration photographs were The two types of OSCC cells conventionally stably trans- taken under a microscope at 0 h and 48 h, respectively. duced (tumor cells with high expression of hsa_- circ_0005379) were cultured in 6-well plates in Migration and invasion assays serum-free medium for 24 h. Supernatant medium was Migration and invasion experiments were performed collected as conditioned medium. After trypsin diges- using a Transwell chamber with or without Matrigel tion, HUVEC cells were centrifuged and the cells were (Corning Life Sciences, NY, USA). The upper chamber is resuspended in serum-free DMEM medium and serum-free DMEM, and the lower chamber is DMEM counted. Then, 3 × 10 cells were added to each well containing 10% FBS. After 24 and 48 h of culture, tumor and the medium was adjusted to 100 μl using serum-free cells which passed through the chamber were fixed and medium. In the lower chamber, two kinds of conditioned stained by 4% paraformaldehyde and 0.1% crystal violet. medium or two kinds of stably transduced cells cultured Images were taken under an inverted microscopy. with serum-free DMEM medium were added. After 24 h, the medium was discarded and the cells were fixed in 4% paraformaldehyde and stained with crystal violet Western blot analysis staining solution. The cells above the membrane were Cellular extracts were prepared at 4 °C in RIPA buffer observed and photographed on an inverted microscopy. (Beyotime Biotechnology, Shanghai, China). Western blot analysis was performed using commercial primary Tube formation assay antibodies against the following proteins: Bcl-2 (1:2000; Matrigel was added to 24-well plates at a concentration ab32124, Abcam), BAX (1:2000; ab32503, Abcam), MMP-9 of 200 μl/well and placed in an incubator for 1 h to (1:2000; ab38898, Abcam), cyclin D1 (1:2000; ab134175, solidify. The HUVECs were inoculated into the above Abcam), GAPDH (1:2000; ab8245, Abcam), vimentin 24-well plate, and the confluency is about 60% when the (1:1000; 5741 T, CST), E-cadherin (1:1000; 3195 T, CST) cells attached. The cells were cultured for 12 h by adding N-cadherin (1:1000; 13,116 T, CST), β-catenin (1:1000; 8480 the above mentioned conditioned medium or OSCC T, CST), EGFR (1:1000; 2085S, CST), CD31 (1:1000; 3528S, cells overexpressing hsa_circ_0005379. The photographs CST) and p-EGFR (1:1000; 3777S, CST). The bands were were taken on an inverted microscopy. detected using HRP-conjugated secondary antibodies from Beyotime Biotechnology (Shanghai, China): goat anti-rabbit Flow cytometry (1:1000, A0208) and goat anti-mouse (1:1000, A0216). Annexin V-FITC Apoptosis Assay Kit (Beyotime Bio- Chemiluminescence was identified using Millipore chromo- technology Co. Ltd., Shanghai, China) was used to meas- genic solution (MilliporeSigma, Burlington, MA, USA). ure the cell apoptosis rate. Tumor cells were seeded into 6-well plates and grown to logarithmic phase. The cells were harvest by digestion and resuspended in 100 μlof Tumorigenesis and staining 1 × annexin-binding buffer. 5 μl of annexin V and 1 μlof Transduced CAL27 cells (2 × 10 cells in 100 μl) were propidium iodide (PI) reagent were added to each well injected into 4-week-old Balb/c athymic nude mice (Siliake and incubated for 15 min. After incubation, 400 μlof Jingda Experimental Animal Co. Ltd., Hunan, China). 1 × annexin-binding buffer was added to stop staining. The tumor volume of nude mice was measured and The apoptosis rate was finally measured using FACSCa- recorded according to V = πAB2/6 (V: tumor volume, A: libur flow cytometer (BD Biosciences, New York, USA). the largest diameter, B: the perpendicular diameter). After 6 weeks, the nude mice were euthanized. Tumors Hoechst 33258 staining experiment of nude mice were dissected and tumor weights were Tumor cells were seeded at 4 × 10 cells/well into measured. Tumor specimens were treated accordingly to 24-well plates and grown to logarithmic phase. Cells perform hematoxylin and eosin (H&E) staining, Western were then fixed using 4% paraformaldehyde and stained blot, IHC staining. by Hoechst 33258 (Beyotime Biotechnology Co. Ltd., Shanghai, China). The morphology and staining of tumor cells nuclei were observed under an inverted Image processing and statistical analysis fluorescence microscopy. All images shown are wide-field microscopy images. Results in graphs are shown as the mean ± SEM from Wound-healing assay three independent experiments. All statistical data were Cells were seeded in 6-well plates and cultured until analyzed using SPSS 17.0 software (SPSS, Chicago, IL, confluent. Use a sterile 200 μl pipette to scratch the bot- USA). Two-tailed Student’s t-tests were used to deter- tom of the 6-well plate. The exfoliated tumor cells were mine P values; P < 0.05 was considered significant. Su et al. BMC Cancer (2019) 19:400 Page 4 of 13 Results Table 1 Correlation between clinicopathological features and hsa_circ_0005379 expression levels in 37 OSCC patients OSCC expresses low levels of hsa_circ_0005379 We determined the RNA levels of hsa_circ_0005379 by Parameter No. of patients Mean ± SEM P value qRT-PCR and analyzed 37 pairs of clinical tissues. It is re- Gender vealed that hsa_circ_0005379 expression was lower in can- Male 27 9.7710 ± 0.4902 0.4225 cerous tissues than adjacent normal tissues (Fig. 1a). We Female 10 10.4700 ± 0.4649 also investigated the expression level of hsa_circ_0005379 in Age (yr) four OSCC cell lines. We observed that hsa_circ_0005379 <60 13 10.9300 ± 0.6460 0.0741 expression was remarkably downregulated in oral cancer cell ≥ 60 24 11.9500 ± 0.2182 lines compared to the expression in HOK cells (Fig. 1b). We also analyzed the correlation between clinicopathological Tumor size (cm) features and hsa_circ_0005379 expression levels in 37 OSCC <5 30 11.4900 ± 0.3732 0.0192 * patients (Table 1). Results showed a negative correlation ≥ 5 7 9.2900 ± 0.9626 between OSCC tumor size (P = 0.0192) and differentiation Differentiation grade grades (P = 0.0057). The ROC curve is shown in Fig. 1c. Well-moderate 12 11.8600 ± 0.5345 0.0057 ** Poor-undifferentiation 25 9.7540 ± 0.4225 Upregulation of hsa_circ_0005379 reduces proliferation and promotes apoptosis in OSCC cells Lymph node status To investigate the role of hsa_circ_0005379 in regulating cell Negative 21 11.4000 ± 0.4521 0.5679 proliferation, we performed the CCK-8 assay on SCC25 and Positive 16 11.8200 ± 0.5790 CAL27 cells overexpressing hsa_circ_0005379. After trans- TNM stage ducing SCC25 and CAL27 cells with hsa_circ_0005379 I-II 13 10.4000 ± 0.6486 0.2432 lentivirus, hsa_circ_0005379 expression levels increased ap- III-IV 24 11.3000 ± 0.4333 proximately 4-fold and 6-fold, respectively (Additional file 1: Figure S1). The OD values were measured to determine the proliferation rate. The results revealed that with an increase in transduction time, hsa_circ_0005379 over- expressing cells showed a significant decrease in pro- liferation rate compared with control group (Fig. 2a). EdU staining was conducted to measure proliferation ratios to a b Fig. 1 Hsa_circ_0005379 is downregulated in OSCC tissue specimens and cell lines. a The relative hsa_circ_0005379 expression level was determined in tissue specimens from patients with OSCC compared with adjacent normal tissues (n = 37) and (b) HOK, CAL27, SCC9, SCC15, and SCC25 cell lines by qRT-PCR. c ROC curve related to hsa_circ_0005379. Data are presented as mean ± S.E.M. of three independent experiments. Student’s t-test,*P < 0.05, ***P < 0.001 Su et al. BMC Cancer (2019) 19:400 Page 5 of 13 Fig. 2 Upregulation of hsa_circ_0005379 inhibits OSCC cell proliferation. a SCC25 and CAL27 cells were transduced with mock control or lentivirus expressing hsa_circ_0005379. The CCK-8 assay was used to measure cell proliferation at different times after transduction. b The EdU incorporation assay was used to measure the proliferation ratio in control SCC25 and CAL27 cells and those overexpressing hsa_circ_0005379. Data are presented as means ± SEM of three independent experiments. Student’s t-test, *P < 0.05, **P < 0.01, ***P < 0.001. Scale bar, 20 μm confirm these results. High expression of hsa_circ_0005379 and CAL27 cells. The scratch area at 0 and 48 h after in SCC25 and CAL27 decreased cell proliferation wounding were measured and revealed that the wound- ratios by approximately 6 and 17% compared to the closure rate in hsa_circ_0005379 overexpression cells control group, respectively (Fig. 2b). Hoechst 33258 was significantly lower than control cells. Closure rate at staining experiments showed that high expression of 48 h in hsa_circ_0005379 overexpression cells was about hsa_circ_0005379 also promoted apoptosis of tumor 18% lower (SCC25; Fig. 4a) and 19.6% lower (CAL27; cells (Fig. 3). Fig. 4b) than those in the control cells. After 24 h of incubation, the number of cells that migrated to the Upregulation of hsa_circ_0005379 inhibits OSCC cell lower chamber in a Transwell assay decreased from migration and invasion abilities 850 to 600 and 300 in SCC25 and CAL27 cells over- To determine the role of hsa_circ_0005379 in OSCC cell expressing hsa_circ_0005379, respectively, (Fig. 4c). migration, wound healing assays were performed on Taken together, these results suggest that OSCC cell control and hsa_circ_0005379 overexpression SCC25 migration ability was impaired by the upregulation of Su et al. BMC Cancer (2019) 19:400 Page 6 of 13 Fig. 3 Upregulation of hsa_circ_0005379 increases apoptosis rate of OSCC cells. Hoechst staining was performed on SCC25 and CAL27 cells transduced with mock control or lentivirus harboring hsa_circ_0005379. The proportion of apoptotic cells was quantified in SCC25 and CAL27 cells. Data are presented as means ± SEM of three independent experiments. Student’s t-test, ***P < 0.001. Scale bar, 20 μm hsa_circ_0005379. To further study OSCC cell invasion 0.91% in SCC25 and CAL27 cells, respectively. Early ability, we also performed a Transwell invasion assay. apoptotic rates in the mock + cetuximab group were After 48 h incubation, the number of cells across the 17.88 and 15.22% in SCC25 and CAL27 cells, respectively, chamber coated with Matrigel was measured. Overexpres- while early cell apoptotic rates in hsa_circ_0005379 + sion of hsa_circ_0005379 strongly suppressed the in- cetuximab group increased to 38.35 and 35.77% in SCC25 vasiveness of SCC25 and CAL27 cells. In both cases, the and CAL27 cells, respectively. Our experimental results invading hsa_circ_0005379 overexpression cells were show that high expression of hsa_circ_0005379 can pro- about half the number of invading control cells (Fig. 4d). mote the apoptosis of tumor cells. OSCC cells with high Co-culture experiments showed that the ability of expression of hsa_circ_0005379 significantly increased the tumor cells to induce HUVEC cell migration de- sensitivity of OSCC cells to cetuximab and promoted creased after overexpressing hsa_circ_0005379 (Fig. 5a, tumor cell apoptosis. b). Moreover, HUVEC tube formation assay was per- formed. Incubated with conditioned medium, over- Hsa_circ_0005379 is involved in the regulation of the expression of hsa_circ_0005379 resulted in less tubule EGFR pathway formation (Fig. 5c). The experimental results showed To explore the mechanism of hsa_circ_0005379 in that overexpression of hsa_circ_0005379 affects the ability regulating OSCC, we examined the expression level of of tumor cells to induce angiogenesis tube formation com- related proteins. The Bcl-2 gene is an oncogene that has pared with the control group. These findings indicate that an inhibitory effect on apoptosis. BAX is an apoptosis- overexpression of hsa_circ_0005379 can not only inhibit promoting protein in the BCL-2 family. Overexpression migration and invasion of OSCC cells, but also influence of BAX antagonizes the protective effect of BCL-2 and the angiogenesis tube formation. causes cell death [13–15]. MMP-9 is capable of de- grading collagen, gelatin, fibronectin, laminin, and dis- Upregualtion of hsa_circ_0005379 enhances the solving the basement membrane, thereby promoting sensitivity of OSCC to anticancer drug cetuximab migration and invasion of tumor cells [16]. The main Since cetuximab is a commonly used anticancer drug for function of cyclin D1 is to promote cell proliferation OSCC treatment, we performed a drug treatment experi- and gene transcription. Cyclin D1 promotes the cell ment to investigate the effect of hsa_circ_0005379 on cycle from the G1 phase to the S phase by binding to OSCC cell viability. Apoptosis rates in hsa_circ_0005379 and activating the cyclin-dependent kinase CDK4, overexpression cells were measured by annexin V-FITC/ which is unique to the G1 phase. Cyclin D1 has been PI dual-label flow cytometry. We used flow cytometry recognized as a proto-oncogene. The overexpression to detect apoptosis in different treatment groups of of Cyclin D1 is associated with malignant transfor- SCC25 (Fig. 6a) and CAL27 (Fig. 6b). Early apoptotic mation [17]. Our results showed that overexpression rates in the mock group were 0.31 and 0.43% in SCC25 of hsa_circ_0005379, BAX was upregulated, whereas Bcl-2, and CAL27 cells, respectively, while early apoptotic MMP-9, and cyclin D1 were downregulated (Fig. 7a). rates in the hsa_circ_0005379 group were 1.12 and Epithelial–mesenchymal transition (EMT) refers to the Su et al. BMC Cancer (2019) 19:400 Page 7 of 13 a b Fig. 4 Upregulation of hsa_circ_0005379 inhibits OSCC cell migration and invasion. a, b Wound healing assays were performed on (a) SCC25 and (b) CAL27 cells transduced with mock control or lentivirus expressing hsa_circ_0005379. The scratch area was measured at 0 and 48 h, and the percentage of closure at 48 h was calculated. c, d A Transwell assay was performed to quantify the migration and invasion ability of SCC25 and CAL27 cells transduced with mock control or lentivirus expressing hsa_circ_0005379. c Cells were seeded into the upper chamber (uncoated). After 24 h, those that crossed to the lower chamber were imaged and quantified. d Cells were seeded into the upper, Matrigel-coated chamber. After 48 h, cells that passed across the coated chamber were imaged and quantified. Data are presented as means ± SEM of three independent experiments. Student’s t-test, ***P < 0.001. Scale bar, 20 μm biological process by which epithelial cells are transformed detected EMT markers by western blot analysis. Compared into mesenchymal phenotype cells by a specific procedure. to control OSCC cells, hsa_circ_0005379 overexpression Through EMT, epithelial cells lose cell polarity and epi- cells showed decreased expression of vimentin and thelial phenotypes such as attachment to the basement N-cadherin and increased expression of E-cadherin and membrane, and thus obtain higher interstitial phenotypes β-catenin (Fig. 7b). Taken together, hsa_circ_0005379 such as migration, invasion, anti-apoptosis, and ability to participates in the EMT process and affects cell proli- degrade extracellular matrix. EMT is an important feration and invasion by regulating the expression levels biological process for the migration and invasion of of several key proteins. epithelial-derived malignant cells [18]. Here, to evaluate Additionally, we used siRNA to knockdown hsa_- the EMT process, we overexpressed hsa_circ_0005379 and circ_0005379 in SCC25 and CAL27 cells. The knockdown Su et al. BMC Cancer (2019) 19:400 Page 8 of 13 Fig. 5 Upregulation of hsa_circ_0005379 attenuates the ability of OSCC cells to induce HUVEC cell migration and angiogenesis formation. a, b HUVEC cells were co-cultured with two kinds of conditioned medium (a) or SCC25 and CAL27 cells transduced with mock control or lentivirus expressing hsa_circ_0005379 (b). Data are presented as means ± SEM of three independent experiments. Student’s t-test, **P <0.01, ***P <0.001. Scale bar, 20 μm. c HUVEC cells were treated with or without conditioned medium for 12 h. Capillary-like tubes were visualized by phase contrast inverted microscopy and calculated efficiency is about 70% in SCC25 and 85% in CAL27 (Fig. 7e). These results suggest that manipulating (Additional file 1: Figure S2). The expression levels of expression levels of hsa_circ_0005379 will influence the BAX, Bcl-2 and MMP-9 are inversely correlated with EGFR pathway. We used EGFR pathway agonists hsa_circ_0005379 expression (Fig. 7c). Western blot re- (NSC228155) and inhibitors (cetuximab) at the indi- sults showed that EGFR and p-EGFR expression levels cated times and concentrations to alter the expression were increased after hsa_circ_0005379 knockdown level of phosphorylated EGFR in the cells and then de- (Fig. 7d), while EGFR and p-EGFR expression levels tected the corresponding hsa_circ_0005379 expression were decreased after hsa_circ_0005379 overexpression level by qRT-PCR. We found no significant change in Su et al. BMC Cancer (2019) 19:400 Page 9 of 13 Fig. 6 Upregulation of hsa_circ_0005379 enhances the sensitivity of OSCC to anticancer drug cetuximab. a, b The SCC25 cells (a) and CAL27 cells (b) transduced with mock control or lentivirus expressing hsa_circ_0005379 were treated with or without cetuximab and analyzed by flow cytometry hsa_circ_0005379 expression levels (Fig. 7f). Moreover, blot results. Expression of EGFR was downregulated in the proliferation differences between hsa_circ_0005379 hsa_circ_0005379 overexpression tumors compared with overexpression and knockdown cell lines treated with the control group. Collectively, these results showed that EGFR inhibitor cetuximab or agonist NSC in different hsa_circ_0005379 is crucial for tumor growth. time points have been investigated, which is shown in Additional file 1: Figure S3. The above results indicate that Discussion hsa_circ_0005379 may be located upstream of the EGFR OSCC is a common malignancy in the head and neck. pathway and regulate the expression level of EGFR. About 540,000 new patients are diagnosed each year. Its high incidence rate poses a serious challenge to public Upregulation of hsa_circ_0005379 suppresses the growth health [19, 20]. Early and well-differentiated OSCCs of OSCC cells in vivo usually achieve good results through active surgical To establish a xenograft tumor model, we injected CAL27 treatment. However, for the advanced and poorly diffe- cell lines in nude mice. Tumors in the hsa_circ_0005379 rentiated OSCC, even treated by surgical treatment, overexpression group were considerably smaller than radiation therapy or chemotherapy, the five-year survival those in the empty-vector group (Mock, Fig. 8a). The rate of the patients is only about 60% [21]. When the tumor growth curve and final weight of the nude mice distant metastasis occurs, the patients’ survival and were suppressed in the hsa_circ_0005379 overexpression quality of life is even more difficult to guarantee [22]. group relative to the control (Fig. 8b, c). Moreover, the CircRNAs is a very peculiar product in the process of H&E staining (Fig. 8d) and western blot (Fig. 8e) showed the transmission and function of life genetic infor- that the angiogenesis marker CD31, EGFR and p-EGFR mation. The current research shows that circRNA is also were downregulated when hsa_circ_0005379 was over- subject to the central law. Due to the particularity of the expressed. Immunohistochemical (IHC) (Fig. 8f) staining structure, circRNA has a unique function different from of xenograft tumors showed that vimentin was downregu- traditional linear nucleic acid molecules [23]. Functional lated in hsa_circ_0005379 overexpressing tumors, while circRNAs have been identified to act as microRNA E-cadherin was upregulated, which supported the western sponges and RNA-binding protein (RBP) sequestering Su et al. BMC Cancer (2019) 19:400 Page 10 of 13 Fig. 7 Up- or downregulation of hsa_circ_0005379 alters the expression levels of key proteins involved in cell proliferation, apoptosis, invasion, and the EGFR signaling pathway. a, c SCC25 and CAL27 cells were subjected to either overexpression (a) or knockdown (c) of hsa_circ_0005379 and cell extracts were immunoblotted with the indicated antibodies. b Key EMT protein levels were detected by western blotting after upregualtion of hsa_circ_0005379 in SCC25 and CAL27 cells. d, e EGFR and p-EGFR protein levels were detected by western blotting after down- (d) or upregulation (e) of hsa_circ_0005379. f The SCC25 and CAL27 cells were treated with EGFR inhibitor cetuximab or agonist NSC. The expression levels of hsa_circ_0005379 were quantified by qRT-PCR. Data are presented as means ± SEM of three independent experiments. Student’s t-test, n.s., not significant agents, as well as transcriptional regulators [24]. These The western blot assay detected significant changes in multiple functional roles indicate great potential for proliferation and apoptosis. EMT plays an important role circRNAs in biological applications. A growing number in the process of tumor invasion. We detected changes in of studies have shown that circRNAs play a regulatory E-Cadherin, β-Catenin, and other core indicators that are role in the tumor progression [9, 25–27]. consistent with our invasion experiment results. The abi- Like other malignancies, the occurrence and develop- lity of angiogenesis is closely related to the occurrence ment of OSCC is a series of complex biological cellular and development of tumors. The stronger the angiogenic processes involved with coding and noncoding genes [28]. ability, the greater the possibility of tumor cell proli- Recently, the regulatory role of circRNAs in OSCC has feration and distant metastasis. Our experiment found also begun to attract attention. Chen et al. found that that after overexpressing hsa_circ_0005379, the ability circRNA_100290 can bind miR-29 through endogenous of tumor cells to induce HUVECs to form blood vessels competition, thereby eliminating miR-29 inhibition of was significantly lower than that of the control group. CDK6 and promoting the proliferation of OSCC cells Tumor angiogenesis can be evaluated from the levels of [29]. Research on circRNAs in OSCC has just begun CD31, also known as platelet endothelial cell adhesion and further research in OSCC-specific circRNA expres- molecule-1 (PECAM-1/CD31). The richer the CD31 sion is needed. In this study, high-throughput circRNA content, the faster the tumor proliferation rate. Our microarray technology was used to screen differentially experimental results showed that after overexpression expressed circRNA in four pairs of cancer tissues of OSCC of hsa_circ_0005379, the CD31 content in nude mice was patients. The series of cytological experiments confirmed significantly lower than that in the control group, indi- that changing the expression level of hsa_circ_0005379 cating that the differential expression of hsa_circ_0005379 can affect the malignant biological behavior of OSCC cells. affected the angiogenesis of tumor cells. Su et al. BMC Cancer (2019) 19:400 Page 11 of 13 Fig. 8 Upregulation of hsa_circ_0005379 inhibits tumorigenesis. a Images of nude mice bearing xenograft tumors generated using CAL27 stable cells and of surgically removed tumors. b Tumor growth curve changes in tumor volume weeks after injection. c Tumor weight plots of mock and hsa_circ_0005379 overexpression groups. d H&E staining of xenograft tumors. e The expression levels of CD31, EGFR and p-EGFR in the experimental groups were determined by western blot. f Immunohistochemical (IHC) staining of xenograft tumors. Data are presented as means ± SEM of three independent experiments. Student’s t-test, **P < 0.01. Scale bars, 50 μm By knocking down hsa_circ_0005379 in SCC25 and EGFR is a tyrosine kinase type I receptor whose family CAL27 cell lines using siRNA, we found that the level members include four homologous receptors: EGFR of proliferation-related apoptosis protein were chan- (HER1), HER2, HER3, and HER4. Studies have shown a ged. However, the results of cytological experiments high or abnormal expression of EGFR in many solid such as CCK-8, wound healing assay, and Transwell tumors, indicating that EGFR is involved in the malig- assays were not significantly different, probably due nant biological behavior of tumor cells [30, 31]. Upregu- to the low level of hsa_circ_0005379 in OSCC lines lation of EGFR is closely related to early metastasis and and the inherent high degree of malignancy of SCC25 poor prognosis. Over 90% of patients with head and and CAL27 cells. neck squamous cell carcinoma test positive for EGFR Su et al. BMC Cancer (2019) 19:400 Page 12 of 13 [32]. In this experiment, the expression level of EGFR Additional file protein in OSCC cell lines SCC25 and CAL27 was sig- Additional file 1: Figure S1. Description of data: Generation of SCC25 nificantly changed by overexpression or knockdown of and CaL27 stable cell lines. Figure S2. The knockdown efficiency of hsa_circ_0005379, indicating that hsa_circ_0005379 siRNA against hsa_circ_0005379. Figure S3. Up- or downregulation of can regulate the EGFR pathway. Using EGFR pathway hsa_circ_0005379 affects cell proliferation. (PDF 7285 kb) agonists and inhibitors to alter the expression levels of phosphorylated EGFR in the cells, we found only Acknowledgments We thank Dr. Weijia Luo for her support. weak expression changes of hsa_circ_0005379 that were not statistically significant. This indicates that Funding hsa_circ_0005379 may be located upstream of the This study was supported by the National Natural Science Foundation of EGFR pathway and regulate EGFR expression levels. China (Grant no. 81572654) to HY, the Basic Research Program of Shenzhen Innovation Council of China (Grant nos. JCYJ20160428173933559 to HY, Based on the high expression of EGFR in OSCC, a JCYJ20150403091443303 to HY, JCYJ20150403091443286 to YW, and series of targeted therapeutics for EGFR have been SZBC2017023 to YW), and the Sanming Project of Medicine in Shenzhen developed [33, 34]. (SZSM 201512036, Oral and Maxillofacial Surgery Team, Professor Yu Guangyan, Stomatology Hospital Peking University) to Department of Oral Cetuximab is a recombinant human murine chimeric and Maxillofacial Surgery, Peking University Shenzhen Hospital, Shenzhen, IgG1 monoclonal antibody, which has high affinity for Guangdong, China. The funding organization has no role in the design of EGFR, inhibits cell cycle progression, and induces tumor the study, analysis, and interpretation the data and in writing the manuscript. cell apoptosis by specifically binding to the extracellular Availability of data and materials EGFR domain. This reduces the production of MMPs The raw data is available from the authors upon reasonable request. and vascular endothelial growth factors, and inhibits tumor invasion and metastasis. Cetuximab has shown Authors’ contributions WS performed the experiments with help from ML. YW and YS designed the good clinical efficacy and tolerability for EGFR expres- experiments. FW and SS performed the qRT-PCR analysis. YS and HY wrote sion in head and neck cancers [35, 36]. This study found the manuscript, with input from all authors. All authors read and approved that changes in early apoptotic rates is not obvious in the final manuscript. cells after high hsa_circ_0005379 expression in SCC25 Ethics approval and consent to participate and CAL27 cell lines. However, when cetuximab was All patients were informed in accordance with the ethical guidelines of added after overexpressing hsa_circ_0005379 in SCC25 Peking University (Protocol No.37923/2-3-2012). This study was approved by and CAL27 cells, the early apoptotic rate of the cells the Ethics Committee of Peking University Health Science Center (IRB00001053–08043). significantly increased to 38.35 and 35.77%, respectively. This indicates that high hsa_circ_0005379 expression Consent for publication increases cetuximab sensitivity and provides a new poten- Not applicable. tial target for OSCC anticancer drugs design in the future. Competing interests Using software, we also identified possible miRNA The authors declare that they have no competing interests. targets of hsa_circ_0005379, including hsa-miR-145, hsa-miR-182. However, the mechanisms still need to be Publisher’sNote investigated in subsequent experiments. To date, only a Springer Nature remains neutral with regard to jurisdictional claims in few functional circRNAs have been reported in OSCC. published maps and institutional affiliations. Therefore, more effort is needed to elucidate the func- Author details tions and key mechanisms of OSCC-specific circRNAs, Department of Oral and Maxillofacial Surgery, Peking University Shenzhen so that circRNAs can be used effectively in translational Hospital, No. 1120 Lianhua Road, Shenzhen 518001, Guangdong, China. and precision medicine. Peking University Shenzhen Hospital Clinical College, Anhui Medical University, Hefei, Anhui, China. Central laboratory, Peking University Shenzhen Hospital, Shenzhen, Guangdong, China. Conclusions Received: 24 November 2018 Accepted: 9 April 2019 Hsa_circ_0005379 is an OSCC tumor suppressor gene associated with tumor size and differentiation. Upregulation References of hsa_circ_0005379 effectively inhibits migration, invasion, 1. Di PB, Bronson NW, Diggs BS, Jr TC, Hunter JG, Dolan JP. The global burden proliferation of OSCC cells and angiogenesis formation in of esophageal Cancer: a disability-adjusted life-year approach. World J Surg. 2016;40:395–401. https://doi.org/10.1007/s00268-015-3356-2. vitro, and suppresses OSCC growth in nude mice. More- 2. Parkin DM, Bray F, Ferlay J, Pisani P. Global Cancer statistics, 2002. CA Cancer over, hsa_circ_0005379 may be involved in the regulation J Clin. 2009;55:74–108. https://doi.org/10.3322/canjclin.55.2.74. of the EGFR pathway by affecting EGFR expression. 3. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin. 2009;59:225–49. https://doi.org/10.3322/caac.20006. Taken together, our findings provide evidence that 4. Omura K. Current status of oral cancer treatment strategies: surgical hsa_circ_0005379 regulates malignant behavior of OSCC treatments for oral squamous cell carcinoma. Int J Clin Oncol. 2014;19:423– and may be a new therapeutic target for OSCC treatment. 30. https://doi.org/10.1007/s10147-014-0689-z. Su et al. BMC Cancer (2019) 19:400 Page 13 of 13 5. Salzman J, Chen RE, Olsen MN, Wang PL, Brown PO. Cell-type specific 25. Wang Y, Mo Y, Gong Z, Yang X, Yang M, Zhang S, Xiong F, Xiang B, features of circular RNA expression. PLoS Genet. 2013;9:e1003777. https:// Zhou M, Liao Q, Zhang W, Li X, Li X, Li Y, Li G, Zeng Z, Xiong W. doi.org/10.1371/journal.pgen.1003777. Circular RNAs in human cancer. Mol Cancer. 2017;16:25. https://doi.org/ 6. Jeck WR, Sorrentino JA, Wang K, Slevin MK, Burd CE, Liu J, Marzluff WF, 10.1186/s12943-017-0598-7. Sharpless NE. Circular RNAs are abundant, conserved, and associated with 26. Yang Z, Xie L, Han L, Qu X, Yang Y, Zhang Y, He Z, Wang Y, Li J. Circular ALU repeats. RNA N Y N. 2013;19:141–57. https://doi.org/10.1261/rna.035667.112. RNAs: regulators of Cancer-related signaling pathways and potential diagnostic biomarkers for human cancers. Theranostics. 2017;7:3106–17. 7. Rybak-Wolf A, Stottmeister C, Glažar P, Jens M, Pino N, Giusti S, Hanan M, https://doi.org/10.7150/thno.19016. Behm M, Bartok O, Ashwal-Fluss R, Herzog M, Schreyer L, Papavasileiou P, 27. Patop IL, Kadener S. circRNAs in Cancer. Curr Opin Genet Dev. 2018;48:121– Ivanov A, Öhman M, Refojo D, Kadener S, Rajewsky N. Circular RNAs in 7. https://doi.org/10.1016/j.gde.2017.11.007. the mammalian brain are highly abundant, conserved, and dynamically 28. Momen-Heravi F, Bala S. Emerging role of non-coding RNA in oral cancer. expressed. Mol Cell. 2015;58:870–85. https://doi.org/10.1016/j.molcel. Cell Signal. 2018;42:134–43. https://doi.org/10.1016/j.cellsig.2017.10.009. 2015.03.027. 29. Chen L, Zhang S, Wu J, Cui J, Zhong L, Zeng L, Ge S. circRNA_100290 plays 8. Chen Y, Li C, Tan C, Liu X. Circular RNAs: a new frontier in the study of a role in oral cancer by functioning as a sponge of the miR-29 family. human diseases. J Med Genet. 2016;53:359–65. https://doi.org/10.1136/ Oncogene. 2017;36:4551–61. https://doi.org/10.1038/onc.2017.89. jmedgenet-2016-103758. 30. Maron SB, Alpert L, Kwak HA, Lomnicki S, Chase L, Xu D, O’Day E, Nagy RJ, 9. Dong Y, He D, Peng Z, Peng W, Shi W, Wang J, Li B, Zhang C, Duan C. Lanman RB, Cecchi F, Hembrough T, Schrock A, Hart J, Xiao S-Y, Setia N, Circular RNAs in cancer: an emerging key player. J. Hematol. Oncol. 2017;10: Catenacci DVT. Targeted therapies for targeted populations: anti-EGFR 2. https://doi.org/10.1186/s13045-016-0370-2. treatment for EGFR-amplified gastroesophageal adenocarcinoma. Cancer 10. Dou Y, Cha DJ, Franklin JL, Higginbotham JN, Jeppesen DK, Weaver AM, Discov. 2018;8:696–713. https://doi.org/10.1158/2159-8290.CD-17-1260. Prasad N, Levy S, Coffey RJ, Patton JG, Zhang B. Circular RNAs are down- 31. Daizumoto K, Yoshimaru T, Matsushita Y, Fukawa T, Uehara H, Ono M, regulated in KRAS mutant colon cancer cells and can be transferred to Komatsu M, Kanayama H-O, Katagiri T. A DDX31/mutant-p53/EGFR Axis exosomes. Sci Rep. 2016;6:37982. https://doi.org/10.1038/srep37982. promotes multistep progression of muscle-invasive bladder Cancer. Cancer 11. Chen J, Li Y, Zheng Q, Bao C, He J, Chen B, Lyu D, Zheng B, Xu Y, Long Z, Res. 2018;78:2233–47. https://doi.org/10.1158/0008-5472.CAN-17-2528. Zhou Y, Zhu H, Wang Y, He X, Shi Y, Huang S. Circular RNA profile identifies 32. Rubin Grandis J, Melhem MF, Barnes EL, Tweardy DJ. Quantitative circPVT1 as a proliferative factor and prognostic marker in gastric cancer. immunohistochemical analysis of transforming growth factor-alpha and Cancer Lett. 2017;388:208–19. https://doi.org/10.1016/j.canlet.2016.12.006. epidermal growth factor receptor in patients with squamous cell carcinoma 12. Wang Y, Li B, Sun S, Li X, Su W, Wang Z, Wang F, Zhang W, Yang H. of the head and neck. Cancer. 1996;78:1284–92. https://doi.org/10.1002/ Circular RNA expression in Oral squamous cell carcinoma. Front Oncol. (SICI)1097-0142(19960915)78:6<1284::AID-CNCR17>3.0.CO;2-X. 2018;8:398. https://doi.org/10.3389/fonc.2018.00398. 33. Vigneswara V, Kong A. Predictive biomarkers and EGFR inhibitors in 13. Bavle RM, Venugopal R, Konda P, Muniswamappa S, Makarla S. Molecular squamous cell carcinoma of head and neck (SCCHN). Ann Oncol Off J Eur classification of Oral squamous cell carcinoma. J Clin Diagn Res JCDR. 2016; Soc. Med Oncol. 2018;29:794–6. https://doi.org/10.1093/annonc/mdy065. 10:ZE18–21. https://doi.org/10.7860/JCDR/2016/19967.8565. 34. Westover D, Zugazagoitia J, Cho BC, Lovly CM, Paz-Ares L. Mechanisms of 14. Campbell KJ, Tait SWG. Targeting BCL-2 regulated apoptosis in cancer. acquired resistance to first- and second-generation EGFR tyrosine kinase Open Biol. 2018;8. https://doi.org/10.1098/rsob.180002. inhibitors. Ann Oncol Off J Eur Soc Med Oncol. 2018;29:i10–9. https://doi. 15. Liu Z, Ding Y, Ye N, Wild C, Chen H, Zhou J. Direct activation of Bax org/10.1093/annonc/mdx703. protein for Cancer therapy. Med Res Rev. 2016;36:313–41. https://doi. 35. DaiW,LiY,ZhouQ,XuZ,Sun C, TanX, LuL.Cetuximabinhibits Oral org/10.1002/med.21379. squamous cell carcinoma invasion and metastasis via degradation of 16. Jacob A, Jing J, Lee J, Schedin P, Gilbert SM, Peden AA, Junutula JR, Prekeris epidermal growth factor receptor. J Oral Pathol Med Off Publ Int Assoc R. Rab40b regulates trafficking of MMP2 and MMP9 during invadopodia Oral Pathol Am Acad. Oral Pathol. 2014;43:250–7. https://doi.org/10. formation and invasion of breast cancer cells. J Cell Sci. 2013;126:4647–58. 1111/jop.12116. https://doi.org/10.1242/jcs.126573. 36. Naruse T, Yanamoto S, Matsushita Y, Sakamoto Y, Morishita K, Ohba S, 17. Ramos-García P, González-Moles MÁ, González-Ruiz L, Ruiz-Ávila I, Ayén Á, Shiraishi T, Yamada S-I, Asahina I, Umeda M. Cetuximab for the treatment of Gil-Montoya JA. Prognostic and clinicopathological significance of cyclin D1 locally advanced and recurrent/metastatic oral cancer: an investigation of expression in oral squamous cell carcinoma: a systematic review and meta- distant metastasis. Mol Clin Oncol. 2016;5:246–52. https://doi.org/10.3892/ analysis. Oral Oncol. 2018;83:96–106. https://doi.org/10.1016/j.oraloncology. mco.2016.928. 2018.06.007. 18. Zhang Y, Weinberg RA. Epithelial-to-mesenchymal transition in cancer: complexity and opportunities. Front Med. 2018;12:361–73. https://doi.org/ 10.1007/s11684-018-0656-6. 19. Siegel R, Ward E, Brawley O, Jemal A. Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin. 2011;61:212–36. https://doi. org/10.3322/caac.20121. 20. La Vecchia C, Lucchini F, Negri E, Levi F. Trends in oral cancer mortality in Europe. Oral Oncol. 2004;40:433–9. https://doi.org/10.1016/j. oraloncology.2003.09.013. 21. Hammerman PS, Hayes DN, Grandis JR. Therapeutic insights from genomic studies of head and neck squamous cell carcinomas. Cancer Discov. 2015;5: 239–44. https://doi.org/10.1158/2159-8290.CD-14-1205. 22. Plataniotis GA, Theofanopoulou M-E, Kalogera-Fountzila A, Haritanti A, Ciuleanou E, Ghilezan N, Zamboglou N, Dimitriadis A, Sofroniadis I, Fountzilas G. Prognostic impact of tumor volumetry in patients with locally advanced head-and-neck carcinoma (non-nasopharyngeal) treated by radiotherapy alone or combined radiochemotherapy in a randomized trial. Int J Radiat Oncol Biol Phys. 2004;59:1018–26. https://doi.org/10.1016/j. ijrobp.2004.01.021. 23. Salzman J. Circular RNA expression: its potential regulation and function. Trends Genet TIG. 2016;32:309–16. https://doi.org/10.1016/j.tig.2016.03.002. 24. Geng Y, Jiang J, Wu C. Function and clinical significance of circRNAs in solid tumors. J Hematol Oncol. 2018;11:98. https://doi.org/10.1186/ s13045-018-0643-z. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Cancer Springer Journals

RETRACTED ARTICLE: Hsa_circ_0005379 regulates malignant behavior of oral squamous cell carcinoma through the EGFR pathway

Download PDF
13 pages

Loading next page...
 
/lp/springer-journals/retracted-article-hsa-circ-0005379-regulates-malignant-behavior-of-N50Zsdbu5I

References (43)

Publisher
Springer Journals
Copyright
Copyright © The Author(s). 2019
Subject
Biomedicine; Cancer Research; Oncology; Surgical Oncology; Health Promotion and Disease Prevention; Biomedicine, general; Medicine/Public Health, general
eISSN
1471-2407
DOI
10.1186/s12885-019-5593-5
Publisher site
See Article on Publisher Site

Abstract

Background: Oral squamous cell carcinoma (OSCC) is an oral and maxillofacial malignancy with a high incidence worldwide. Accumulating evidence indicates that circular RNAs (circRNAs) play a vital role in modulating tumor development. However, the mechanism of circRNA action in human OSCC remains largely unknown. Methods: By using high-throughput transcriptome sequencing technology, we conducted a comprehensive study of circRNAs in human OSCC. The effect of circRNA hsa_circ_0005379 on OSCC tissues and cell lines was monitored by qRT-PCR, Transwell assay, flow cytometry, and western blot analysis. Xenograft mouse models were used to assess tumor growth and animal survival. Results: We found that circRNA hsa_circ_0005379 expression is significantly lower in OSCC tissue compared to paired non-cancerous matched tissue and is associated with tumor size and differentiation. Overexpression of hsa_circ_0005379 effectively inhibits migration, invasion, and proliferation of OSCC cells in vitro and suppresses OSCC growth in nude mice in vivo. Mechanistic studies revealed that hsa_circ_0005379 may be involved in the regulation of the epidermal growth factor receptor (EGFR) pathway. Furthermore, we found that high expression of hsa_circ_0005379 could significantly enhance the sensitivity of OSCC to the cetuximab drug. Conclusions: Our findings provide evidence that hsa_circ_0005379 regulates OSCC malignancy and may be a new therapeutic target for OSCC treatment. Keywords: Oral squamous cell carcinoma, Circular RNAs, EGFR pathway, Cetuximab, Epithelial–mesenchymal transition Background cancer is even lower. OSCC has become a progressively Oral squamous cell carcinoma (OSCC) is an invasive ma- serious global problem. lignant tumor with different degrees of differentiation. The Circular RNAs (circRNAs) are a class of noncoding poor-differentiated OSCC has a tendency to metastasize to RNA molecules that do not have a 5′-end cap or 3′-end early lymph nodes [1]. It accounts for about 3% of the poly (A) tail. Previous reports have shown that circular world’s malignant tumors [2]. Every year, 1.6 million people RNAs are endogenous, stable, abundant, and conserved are diagnosed and 333,000 people die from head and neck RNA molecules that can have cell type- or developmen- squamous cell carcinoma (HNSCC), of which half the tal stage-specific expression patterns in eukaryotic cells cases are OSCC [3]. Moreover, incidence rates of OSCC in [5–7]. Studies have revealed the presence of differentially developing countries are higher than developed countries expressed circular RNA in various tumor tissues, which [2]. The latest academic statistics shows that the five-year are significantly associated with distant metastases, survival rate of patients with OSCC is about 60% [4], TNM staging, and other clinical features [8, 9]. Including while the 5-year survival rate of patients with advanced colon, gastric, and esophageal cancers [10, 11]. Studying features of circRNAs can provide new insights into tumor pathogenesis. However, literature on the expres- * Correspondence: yuehongshen@hotmail.com; hyyang192@hotmail.com sion of circular RNA in oral squamous cell carcinoma Department of Oral and Maxillofacial Surgery, Peking University Shenzhen is limited. Hospital, No. 1120 Lianhua Road, Shenzhen 518001, Guangdong, China Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Su et al. BMC Cancer (2019) 19:400 Page 2 of 13 To investigate the regulatory role of circRNAs in Lipofectamine 3000 (Gibco, New York, USA) was OSCC, high-throughput sequencing was used to screen used for siRNA transfection. All three siRNAs gave differentially expressed circular RNA in paired OSCC identical results. tissues and adjacent normal tissue samples [12]. We found that hsa_circ_0005379 is an OSCC tumor sup- Lentivirus infection and monoclonal cell screening pressor gene associated with tumor size and differenti- The lentiviral plasmid containing GFP and puromycin-re- ation. Upregalation of hsa_circ_0005379 effectively sistant gene was constructed by HanBio Co. Ltd. (Shang- inhibits migration, invasion, proliferation of OSCC cells hai, China). Polybrene/medium mixture with packaged and angiogenesis formation in vitro, and suppresses lentivirus was incubated with SCC25 and CAL27 cells for OSCC growth in nude mice in vivo. We also found that 48 h. After infection, the transduced cells were screened hsa_circ_0005379 may be involved in the regulation of by puromycin (SCC25, 6 μg/ml; CAL27, 10 μg/ml; Qcbio the epidermal growth factor receptor (EGFR) pathway Science & Technologies Co. Ltd. Shanghai, China). The by affecting EGFR expression. Moreover, our study screened cells were diluted and plated into 96-well showed that high expression of hsa_circ_0005379 com- plates to get a single cell per well. Monoclonal cells bined with cetuximab can significantly promote OSCC were verified by qRT-PCR. Fluorescence microscopy cell apoptosis. Taken together, our findings provide was used to observe the expression of GFP in infected evidence that hsa_circ_0005379 regulates cancer and cells. may be a new therapeutic target for OSCC treatment. RNA preparation and qRT-PCR Total RNA was extracted with an RNeasy Mini Kit Methods (QIAGEN, Hilden, Germany). RNA was incubated with Patients and tissue samples 3 U/mg RNase R (Epicenter) for 15 min at 37 °C. For All patient tissue samples were obtained from the Stoma- reverse transcription, 500 ng of RNase R-treated RNA tological Center of Peking University Shenzhen Hospital was reverse transcribed using Prime Script RT Master (Shenzhen, China), between 2016 and 2018. Patients Mix (Takara Bio Inc., Kusatsu, Japan). PCR reactions enrolled in the study was selected to rule out systemic were performed using PCR Master Mix (2×) (Thermo disease and preoperative radiotherapy or chemotherapy. Fisher Scientific, Waltham, MA, USA). Primers used for The histopathological grading of tumors was performed qRT-PCR are listed as follows: according to the 2018 World Health Organization classi- hsa_circ_0005379-F1: GCCCATACCTTTATCCACTC fication criteria for head and neck cancer. The circular hsa_circ_0005379-R1: GTCAACATTCCAGTCTCTTCCT RNA profiling was obtained through high-throughput hsa_circ_0005379-F2: CCTAAGAAGACCACAATGCG sequencing of four pairs of specimens. (Guangzhou Gene hsa_circ_0005379-R2:CCTCCGTAGTAAGGGTTTCG Denovo Biotechnology Co. Ltd., Guangzhou, China). This β-actin-F: AAACTGGAACGGTGAAGGTG study was approved by the Ethics Committee of Peking β-actin-R: AGTGGGGTGGCTTTTAGGAT. University Health Science Center (IRB00001053–08043). CCK-8 assay Tumor cells were seeded into 96-well plates at 2 × 10 Cell culture and transfection cells per well. CCK-8 (Beyotime, Shanghai, China) was HumanOSCCcelllines SCC9,SCC15,SCC25,and CAL27 added at 10 μl/well at different time points and incubated are gifts given by Wuhan University (Wuhan, China). for 1 h. The OD value at 450 nm absorbance was mea- Human oral keratinocyte (HOK) cells were obtained sured. To treat the cells with EGFR drugs, NSC228155 from the cell bank of the Chinese Academy of Sciences was added at the concentration of 29 μg/ml and incubated (Shanghai, China). All cells were cultured in Dulbecco’s for 15 min. Cetuximab was added at the concentration of modified Eagle medium (DMEM; Gibco, New York, 10 μg/ml and incubated for 72 h. USA). Human umbilical vein endothelial cells (HUVEC) and culture medium were bought from Procell Life Science and Technology Company (WuHan, China). 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay All cell lines were cultured at 37 °C incubator with 5% Tumor cells were seeded at 4 × 10 cells/well into 96-well CO . The siRNAs for hsa_circ_0005379 were synthe- plates and grown to logarithmic phase. Then EdU dye, sized by RiboBio Co. Ltd. (Guangzhou, China). The siRNA PBS buffer, Apollo and Hoechst 33342 (Beyotime Biotech- sequences are as follows: nology, Shanghai, China) were used to stain the cells, siRNA-1: 5′-CAAGGAAUGUAUCCUGUCA-3′; respectively. Images were taken randomly under a siRNA-2: 5′-AAGGAUUUGCAAGGAAUGUAU-3′; fluorescence microscopy. The cells were counted using siRNA-3: 5′-GAUUUGCAAGGAAUGUAUCCU-3′. Image J software. Su et al. BMC Cancer (2019) 19:400 Page 3 of 13 Co-cultivation experiment washed with PBS, and cell migration photographs were The two types of OSCC cells conventionally stably trans- taken under a microscope at 0 h and 48 h, respectively. duced (tumor cells with high expression of hsa_- circ_0005379) were cultured in 6-well plates in Migration and invasion assays serum-free medium for 24 h. Supernatant medium was Migration and invasion experiments were performed collected as conditioned medium. After trypsin diges- using a Transwell chamber with or without Matrigel tion, HUVEC cells were centrifuged and the cells were (Corning Life Sciences, NY, USA). The upper chamber is resuspended in serum-free DMEM medium and serum-free DMEM, and the lower chamber is DMEM counted. Then, 3 × 10 cells were added to each well containing 10% FBS. After 24 and 48 h of culture, tumor and the medium was adjusted to 100 μl using serum-free cells which passed through the chamber were fixed and medium. In the lower chamber, two kinds of conditioned stained by 4% paraformaldehyde and 0.1% crystal violet. medium or two kinds of stably transduced cells cultured Images were taken under an inverted microscopy. with serum-free DMEM medium were added. After 24 h, the medium was discarded and the cells were fixed in 4% paraformaldehyde and stained with crystal violet Western blot analysis staining solution. The cells above the membrane were Cellular extracts were prepared at 4 °C in RIPA buffer observed and photographed on an inverted microscopy. (Beyotime Biotechnology, Shanghai, China). Western blot analysis was performed using commercial primary Tube formation assay antibodies against the following proteins: Bcl-2 (1:2000; Matrigel was added to 24-well plates at a concentration ab32124, Abcam), BAX (1:2000; ab32503, Abcam), MMP-9 of 200 μl/well and placed in an incubator for 1 h to (1:2000; ab38898, Abcam), cyclin D1 (1:2000; ab134175, solidify. The HUVECs were inoculated into the above Abcam), GAPDH (1:2000; ab8245, Abcam), vimentin 24-well plate, and the confluency is about 60% when the (1:1000; 5741 T, CST), E-cadherin (1:1000; 3195 T, CST) cells attached. The cells were cultured for 12 h by adding N-cadherin (1:1000; 13,116 T, CST), β-catenin (1:1000; 8480 the above mentioned conditioned medium or OSCC T, CST), EGFR (1:1000; 2085S, CST), CD31 (1:1000; 3528S, cells overexpressing hsa_circ_0005379. The photographs CST) and p-EGFR (1:1000; 3777S, CST). The bands were were taken on an inverted microscopy. detected using HRP-conjugated secondary antibodies from Beyotime Biotechnology (Shanghai, China): goat anti-rabbit Flow cytometry (1:1000, A0208) and goat anti-mouse (1:1000, A0216). Annexin V-FITC Apoptosis Assay Kit (Beyotime Bio- Chemiluminescence was identified using Millipore chromo- technology Co. Ltd., Shanghai, China) was used to meas- genic solution (MilliporeSigma, Burlington, MA, USA). ure the cell apoptosis rate. Tumor cells were seeded into 6-well plates and grown to logarithmic phase. The cells were harvest by digestion and resuspended in 100 μlof Tumorigenesis and staining 1 × annexin-binding buffer. 5 μl of annexin V and 1 μlof Transduced CAL27 cells (2 × 10 cells in 100 μl) were propidium iodide (PI) reagent were added to each well injected into 4-week-old Balb/c athymic nude mice (Siliake and incubated for 15 min. After incubation, 400 μlof Jingda Experimental Animal Co. Ltd., Hunan, China). 1 × annexin-binding buffer was added to stop staining. The tumor volume of nude mice was measured and The apoptosis rate was finally measured using FACSCa- recorded according to V = πAB2/6 (V: tumor volume, A: libur flow cytometer (BD Biosciences, New York, USA). the largest diameter, B: the perpendicular diameter). After 6 weeks, the nude mice were euthanized. Tumors Hoechst 33258 staining experiment of nude mice were dissected and tumor weights were Tumor cells were seeded at 4 × 10 cells/well into measured. Tumor specimens were treated accordingly to 24-well plates and grown to logarithmic phase. Cells perform hematoxylin and eosin (H&E) staining, Western were then fixed using 4% paraformaldehyde and stained blot, IHC staining. by Hoechst 33258 (Beyotime Biotechnology Co. Ltd., Shanghai, China). The morphology and staining of tumor cells nuclei were observed under an inverted Image processing and statistical analysis fluorescence microscopy. All images shown are wide-field microscopy images. Results in graphs are shown as the mean ± SEM from Wound-healing assay three independent experiments. All statistical data were Cells were seeded in 6-well plates and cultured until analyzed using SPSS 17.0 software (SPSS, Chicago, IL, confluent. Use a sterile 200 μl pipette to scratch the bot- USA). Two-tailed Student’s t-tests were used to deter- tom of the 6-well plate. The exfoliated tumor cells were mine P values; P < 0.05 was considered significant. Su et al. BMC Cancer (2019) 19:400 Page 4 of 13 Results Table 1 Correlation between clinicopathological features and hsa_circ_0005379 expression levels in 37 OSCC patients OSCC expresses low levels of hsa_circ_0005379 We determined the RNA levels of hsa_circ_0005379 by Parameter No. of patients Mean ± SEM P value qRT-PCR and analyzed 37 pairs of clinical tissues. It is re- Gender vealed that hsa_circ_0005379 expression was lower in can- Male 27 9.7710 ± 0.4902 0.4225 cerous tissues than adjacent normal tissues (Fig. 1a). We Female 10 10.4700 ± 0.4649 also investigated the expression level of hsa_circ_0005379 in Age (yr) four OSCC cell lines. We observed that hsa_circ_0005379 <60 13 10.9300 ± 0.6460 0.0741 expression was remarkably downregulated in oral cancer cell ≥ 60 24 11.9500 ± 0.2182 lines compared to the expression in HOK cells (Fig. 1b). We also analyzed the correlation between clinicopathological Tumor size (cm) features and hsa_circ_0005379 expression levels in 37 OSCC <5 30 11.4900 ± 0.3732 0.0192 * patients (Table 1). Results showed a negative correlation ≥ 5 7 9.2900 ± 0.9626 between OSCC tumor size (P = 0.0192) and differentiation Differentiation grade grades (P = 0.0057). The ROC curve is shown in Fig. 1c. Well-moderate 12 11.8600 ± 0.5345 0.0057 ** Poor-undifferentiation 25 9.7540 ± 0.4225 Upregulation of hsa_circ_0005379 reduces proliferation and promotes apoptosis in OSCC cells Lymph node status To investigate the role of hsa_circ_0005379 in regulating cell Negative 21 11.4000 ± 0.4521 0.5679 proliferation, we performed the CCK-8 assay on SCC25 and Positive 16 11.8200 ± 0.5790 CAL27 cells overexpressing hsa_circ_0005379. After trans- TNM stage ducing SCC25 and CAL27 cells with hsa_circ_0005379 I-II 13 10.4000 ± 0.6486 0.2432 lentivirus, hsa_circ_0005379 expression levels increased ap- III-IV 24 11.3000 ± 0.4333 proximately 4-fold and 6-fold, respectively (Additional file 1: Figure S1). The OD values were measured to determine the proliferation rate. The results revealed that with an increase in transduction time, hsa_circ_0005379 over- expressing cells showed a significant decrease in pro- liferation rate compared with control group (Fig. 2a). EdU staining was conducted to measure proliferation ratios to a b Fig. 1 Hsa_circ_0005379 is downregulated in OSCC tissue specimens and cell lines. a The relative hsa_circ_0005379 expression level was determined in tissue specimens from patients with OSCC compared with adjacent normal tissues (n = 37) and (b) HOK, CAL27, SCC9, SCC15, and SCC25 cell lines by qRT-PCR. c ROC curve related to hsa_circ_0005379. Data are presented as mean ± S.E.M. of three independent experiments. Student’s t-test,*P < 0.05, ***P < 0.001 Su et al. BMC Cancer (2019) 19:400 Page 5 of 13 Fig. 2 Upregulation of hsa_circ_0005379 inhibits OSCC cell proliferation. a SCC25 and CAL27 cells were transduced with mock control or lentivirus expressing hsa_circ_0005379. The CCK-8 assay was used to measure cell proliferation at different times after transduction. b The EdU incorporation assay was used to measure the proliferation ratio in control SCC25 and CAL27 cells and those overexpressing hsa_circ_0005379. Data are presented as means ± SEM of three independent experiments. Student’s t-test, *P < 0.05, **P < 0.01, ***P < 0.001. Scale bar, 20 μm confirm these results. High expression of hsa_circ_0005379 and CAL27 cells. The scratch area at 0 and 48 h after in SCC25 and CAL27 decreased cell proliferation wounding were measured and revealed that the wound- ratios by approximately 6 and 17% compared to the closure rate in hsa_circ_0005379 overexpression cells control group, respectively (Fig. 2b). Hoechst 33258 was significantly lower than control cells. Closure rate at staining experiments showed that high expression of 48 h in hsa_circ_0005379 overexpression cells was about hsa_circ_0005379 also promoted apoptosis of tumor 18% lower (SCC25; Fig. 4a) and 19.6% lower (CAL27; cells (Fig. 3). Fig. 4b) than those in the control cells. After 24 h of incubation, the number of cells that migrated to the Upregulation of hsa_circ_0005379 inhibits OSCC cell lower chamber in a Transwell assay decreased from migration and invasion abilities 850 to 600 and 300 in SCC25 and CAL27 cells over- To determine the role of hsa_circ_0005379 in OSCC cell expressing hsa_circ_0005379, respectively, (Fig. 4c). migration, wound healing assays were performed on Taken together, these results suggest that OSCC cell control and hsa_circ_0005379 overexpression SCC25 migration ability was impaired by the upregulation of Su et al. BMC Cancer (2019) 19:400 Page 6 of 13 Fig. 3 Upregulation of hsa_circ_0005379 increases apoptosis rate of OSCC cells. Hoechst staining was performed on SCC25 and CAL27 cells transduced with mock control or lentivirus harboring hsa_circ_0005379. The proportion of apoptotic cells was quantified in SCC25 and CAL27 cells. Data are presented as means ± SEM of three independent experiments. Student’s t-test, ***P < 0.001. Scale bar, 20 μm hsa_circ_0005379. To further study OSCC cell invasion 0.91% in SCC25 and CAL27 cells, respectively. Early ability, we also performed a Transwell invasion assay. apoptotic rates in the mock + cetuximab group were After 48 h incubation, the number of cells across the 17.88 and 15.22% in SCC25 and CAL27 cells, respectively, chamber coated with Matrigel was measured. Overexpres- while early cell apoptotic rates in hsa_circ_0005379 + sion of hsa_circ_0005379 strongly suppressed the in- cetuximab group increased to 38.35 and 35.77% in SCC25 vasiveness of SCC25 and CAL27 cells. In both cases, the and CAL27 cells, respectively. Our experimental results invading hsa_circ_0005379 overexpression cells were show that high expression of hsa_circ_0005379 can pro- about half the number of invading control cells (Fig. 4d). mote the apoptosis of tumor cells. OSCC cells with high Co-culture experiments showed that the ability of expression of hsa_circ_0005379 significantly increased the tumor cells to induce HUVEC cell migration de- sensitivity of OSCC cells to cetuximab and promoted creased after overexpressing hsa_circ_0005379 (Fig. 5a, tumor cell apoptosis. b). Moreover, HUVEC tube formation assay was per- formed. Incubated with conditioned medium, over- Hsa_circ_0005379 is involved in the regulation of the expression of hsa_circ_0005379 resulted in less tubule EGFR pathway formation (Fig. 5c). The experimental results showed To explore the mechanism of hsa_circ_0005379 in that overexpression of hsa_circ_0005379 affects the ability regulating OSCC, we examined the expression level of of tumor cells to induce angiogenesis tube formation com- related proteins. The Bcl-2 gene is an oncogene that has pared with the control group. These findings indicate that an inhibitory effect on apoptosis. BAX is an apoptosis- overexpression of hsa_circ_0005379 can not only inhibit promoting protein in the BCL-2 family. Overexpression migration and invasion of OSCC cells, but also influence of BAX antagonizes the protective effect of BCL-2 and the angiogenesis tube formation. causes cell death [13–15]. MMP-9 is capable of de- grading collagen, gelatin, fibronectin, laminin, and dis- Upregualtion of hsa_circ_0005379 enhances the solving the basement membrane, thereby promoting sensitivity of OSCC to anticancer drug cetuximab migration and invasion of tumor cells [16]. The main Since cetuximab is a commonly used anticancer drug for function of cyclin D1 is to promote cell proliferation OSCC treatment, we performed a drug treatment experi- and gene transcription. Cyclin D1 promotes the cell ment to investigate the effect of hsa_circ_0005379 on cycle from the G1 phase to the S phase by binding to OSCC cell viability. Apoptosis rates in hsa_circ_0005379 and activating the cyclin-dependent kinase CDK4, overexpression cells were measured by annexin V-FITC/ which is unique to the G1 phase. Cyclin D1 has been PI dual-label flow cytometry. We used flow cytometry recognized as a proto-oncogene. The overexpression to detect apoptosis in different treatment groups of of Cyclin D1 is associated with malignant transfor- SCC25 (Fig. 6a) and CAL27 (Fig. 6b). Early apoptotic mation [17]. Our results showed that overexpression rates in the mock group were 0.31 and 0.43% in SCC25 of hsa_circ_0005379, BAX was upregulated, whereas Bcl-2, and CAL27 cells, respectively, while early apoptotic MMP-9, and cyclin D1 were downregulated (Fig. 7a). rates in the hsa_circ_0005379 group were 1.12 and Epithelial–mesenchymal transition (EMT) refers to the Su et al. BMC Cancer (2019) 19:400 Page 7 of 13 a b Fig. 4 Upregulation of hsa_circ_0005379 inhibits OSCC cell migration and invasion. a, b Wound healing assays were performed on (a) SCC25 and (b) CAL27 cells transduced with mock control or lentivirus expressing hsa_circ_0005379. The scratch area was measured at 0 and 48 h, and the percentage of closure at 48 h was calculated. c, d A Transwell assay was performed to quantify the migration and invasion ability of SCC25 and CAL27 cells transduced with mock control or lentivirus expressing hsa_circ_0005379. c Cells were seeded into the upper chamber (uncoated). After 24 h, those that crossed to the lower chamber were imaged and quantified. d Cells were seeded into the upper, Matrigel-coated chamber. After 48 h, cells that passed across the coated chamber were imaged and quantified. Data are presented as means ± SEM of three independent experiments. Student’s t-test, ***P < 0.001. Scale bar, 20 μm biological process by which epithelial cells are transformed detected EMT markers by western blot analysis. Compared into mesenchymal phenotype cells by a specific procedure. to control OSCC cells, hsa_circ_0005379 overexpression Through EMT, epithelial cells lose cell polarity and epi- cells showed decreased expression of vimentin and thelial phenotypes such as attachment to the basement N-cadherin and increased expression of E-cadherin and membrane, and thus obtain higher interstitial phenotypes β-catenin (Fig. 7b). Taken together, hsa_circ_0005379 such as migration, invasion, anti-apoptosis, and ability to participates in the EMT process and affects cell proli- degrade extracellular matrix. EMT is an important feration and invasion by regulating the expression levels biological process for the migration and invasion of of several key proteins. epithelial-derived malignant cells [18]. Here, to evaluate Additionally, we used siRNA to knockdown hsa_- the EMT process, we overexpressed hsa_circ_0005379 and circ_0005379 in SCC25 and CAL27 cells. The knockdown Su et al. BMC Cancer (2019) 19:400 Page 8 of 13 Fig. 5 Upregulation of hsa_circ_0005379 attenuates the ability of OSCC cells to induce HUVEC cell migration and angiogenesis formation. a, b HUVEC cells were co-cultured with two kinds of conditioned medium (a) or SCC25 and CAL27 cells transduced with mock control or lentivirus expressing hsa_circ_0005379 (b). Data are presented as means ± SEM of three independent experiments. Student’s t-test, **P <0.01, ***P <0.001. Scale bar, 20 μm. c HUVEC cells were treated with or without conditioned medium for 12 h. Capillary-like tubes were visualized by phase contrast inverted microscopy and calculated efficiency is about 70% in SCC25 and 85% in CAL27 (Fig. 7e). These results suggest that manipulating (Additional file 1: Figure S2). The expression levels of expression levels of hsa_circ_0005379 will influence the BAX, Bcl-2 and MMP-9 are inversely correlated with EGFR pathway. We used EGFR pathway agonists hsa_circ_0005379 expression (Fig. 7c). Western blot re- (NSC228155) and inhibitors (cetuximab) at the indi- sults showed that EGFR and p-EGFR expression levels cated times and concentrations to alter the expression were increased after hsa_circ_0005379 knockdown level of phosphorylated EGFR in the cells and then de- (Fig. 7d), while EGFR and p-EGFR expression levels tected the corresponding hsa_circ_0005379 expression were decreased after hsa_circ_0005379 overexpression level by qRT-PCR. We found no significant change in Su et al. BMC Cancer (2019) 19:400 Page 9 of 13 Fig. 6 Upregulation of hsa_circ_0005379 enhances the sensitivity of OSCC to anticancer drug cetuximab. a, b The SCC25 cells (a) and CAL27 cells (b) transduced with mock control or lentivirus expressing hsa_circ_0005379 were treated with or without cetuximab and analyzed by flow cytometry hsa_circ_0005379 expression levels (Fig. 7f). Moreover, blot results. Expression of EGFR was downregulated in the proliferation differences between hsa_circ_0005379 hsa_circ_0005379 overexpression tumors compared with overexpression and knockdown cell lines treated with the control group. Collectively, these results showed that EGFR inhibitor cetuximab or agonist NSC in different hsa_circ_0005379 is crucial for tumor growth. time points have been investigated, which is shown in Additional file 1: Figure S3. The above results indicate that Discussion hsa_circ_0005379 may be located upstream of the EGFR OSCC is a common malignancy in the head and neck. pathway and regulate the expression level of EGFR. About 540,000 new patients are diagnosed each year. Its high incidence rate poses a serious challenge to public Upregulation of hsa_circ_0005379 suppresses the growth health [19, 20]. Early and well-differentiated OSCCs of OSCC cells in vivo usually achieve good results through active surgical To establish a xenograft tumor model, we injected CAL27 treatment. However, for the advanced and poorly diffe- cell lines in nude mice. Tumors in the hsa_circ_0005379 rentiated OSCC, even treated by surgical treatment, overexpression group were considerably smaller than radiation therapy or chemotherapy, the five-year survival those in the empty-vector group (Mock, Fig. 8a). The rate of the patients is only about 60% [21]. When the tumor growth curve and final weight of the nude mice distant metastasis occurs, the patients’ survival and were suppressed in the hsa_circ_0005379 overexpression quality of life is even more difficult to guarantee [22]. group relative to the control (Fig. 8b, c). Moreover, the CircRNAs is a very peculiar product in the process of H&E staining (Fig. 8d) and western blot (Fig. 8e) showed the transmission and function of life genetic infor- that the angiogenesis marker CD31, EGFR and p-EGFR mation. The current research shows that circRNA is also were downregulated when hsa_circ_0005379 was over- subject to the central law. Due to the particularity of the expressed. Immunohistochemical (IHC) (Fig. 8f) staining structure, circRNA has a unique function different from of xenograft tumors showed that vimentin was downregu- traditional linear nucleic acid molecules [23]. Functional lated in hsa_circ_0005379 overexpressing tumors, while circRNAs have been identified to act as microRNA E-cadherin was upregulated, which supported the western sponges and RNA-binding protein (RBP) sequestering Su et al. BMC Cancer (2019) 19:400 Page 10 of 13 Fig. 7 Up- or downregulation of hsa_circ_0005379 alters the expression levels of key proteins involved in cell proliferation, apoptosis, invasion, and the EGFR signaling pathway. a, c SCC25 and CAL27 cells were subjected to either overexpression (a) or knockdown (c) of hsa_circ_0005379 and cell extracts were immunoblotted with the indicated antibodies. b Key EMT protein levels were detected by western blotting after upregualtion of hsa_circ_0005379 in SCC25 and CAL27 cells. d, e EGFR and p-EGFR protein levels were detected by western blotting after down- (d) or upregulation (e) of hsa_circ_0005379. f The SCC25 and CAL27 cells were treated with EGFR inhibitor cetuximab or agonist NSC. The expression levels of hsa_circ_0005379 were quantified by qRT-PCR. Data are presented as means ± SEM of three independent experiments. Student’s t-test, n.s., not significant agents, as well as transcriptional regulators [24]. These The western blot assay detected significant changes in multiple functional roles indicate great potential for proliferation and apoptosis. EMT plays an important role circRNAs in biological applications. A growing number in the process of tumor invasion. We detected changes in of studies have shown that circRNAs play a regulatory E-Cadherin, β-Catenin, and other core indicators that are role in the tumor progression [9, 25–27]. consistent with our invasion experiment results. The abi- Like other malignancies, the occurrence and develop- lity of angiogenesis is closely related to the occurrence ment of OSCC is a series of complex biological cellular and development of tumors. The stronger the angiogenic processes involved with coding and noncoding genes [28]. ability, the greater the possibility of tumor cell proli- Recently, the regulatory role of circRNAs in OSCC has feration and distant metastasis. Our experiment found also begun to attract attention. Chen et al. found that that after overexpressing hsa_circ_0005379, the ability circRNA_100290 can bind miR-29 through endogenous of tumor cells to induce HUVECs to form blood vessels competition, thereby eliminating miR-29 inhibition of was significantly lower than that of the control group. CDK6 and promoting the proliferation of OSCC cells Tumor angiogenesis can be evaluated from the levels of [29]. Research on circRNAs in OSCC has just begun CD31, also known as platelet endothelial cell adhesion and further research in OSCC-specific circRNA expres- molecule-1 (PECAM-1/CD31). The richer the CD31 sion is needed. In this study, high-throughput circRNA content, the faster the tumor proliferation rate. Our microarray technology was used to screen differentially experimental results showed that after overexpression expressed circRNA in four pairs of cancer tissues of OSCC of hsa_circ_0005379, the CD31 content in nude mice was patients. The series of cytological experiments confirmed significantly lower than that in the control group, indi- that changing the expression level of hsa_circ_0005379 cating that the differential expression of hsa_circ_0005379 can affect the malignant biological behavior of OSCC cells. affected the angiogenesis of tumor cells. Su et al. BMC Cancer (2019) 19:400 Page 11 of 13 Fig. 8 Upregulation of hsa_circ_0005379 inhibits tumorigenesis. a Images of nude mice bearing xenograft tumors generated using CAL27 stable cells and of surgically removed tumors. b Tumor growth curve changes in tumor volume weeks after injection. c Tumor weight plots of mock and hsa_circ_0005379 overexpression groups. d H&E staining of xenograft tumors. e The expression levels of CD31, EGFR and p-EGFR in the experimental groups were determined by western blot. f Immunohistochemical (IHC) staining of xenograft tumors. Data are presented as means ± SEM of three independent experiments. Student’s t-test, **P < 0.01. Scale bars, 50 μm By knocking down hsa_circ_0005379 in SCC25 and EGFR is a tyrosine kinase type I receptor whose family CAL27 cell lines using siRNA, we found that the level members include four homologous receptors: EGFR of proliferation-related apoptosis protein were chan- (HER1), HER2, HER3, and HER4. Studies have shown a ged. However, the results of cytological experiments high or abnormal expression of EGFR in many solid such as CCK-8, wound healing assay, and Transwell tumors, indicating that EGFR is involved in the malig- assays were not significantly different, probably due nant biological behavior of tumor cells [30, 31]. Upregu- to the low level of hsa_circ_0005379 in OSCC lines lation of EGFR is closely related to early metastasis and and the inherent high degree of malignancy of SCC25 poor prognosis. Over 90% of patients with head and and CAL27 cells. neck squamous cell carcinoma test positive for EGFR Su et al. BMC Cancer (2019) 19:400 Page 12 of 13 [32]. In this experiment, the expression level of EGFR Additional file protein in OSCC cell lines SCC25 and CAL27 was sig- Additional file 1: Figure S1. Description of data: Generation of SCC25 nificantly changed by overexpression or knockdown of and CaL27 stable cell lines. Figure S2. The knockdown efficiency of hsa_circ_0005379, indicating that hsa_circ_0005379 siRNA against hsa_circ_0005379. Figure S3. Up- or downregulation of can regulate the EGFR pathway. Using EGFR pathway hsa_circ_0005379 affects cell proliferation. (PDF 7285 kb) agonists and inhibitors to alter the expression levels of phosphorylated EGFR in the cells, we found only Acknowledgments We thank Dr. Weijia Luo for her support. weak expression changes of hsa_circ_0005379 that were not statistically significant. This indicates that Funding hsa_circ_0005379 may be located upstream of the This study was supported by the National Natural Science Foundation of EGFR pathway and regulate EGFR expression levels. China (Grant no. 81572654) to HY, the Basic Research Program of Shenzhen Innovation Council of China (Grant nos. JCYJ20160428173933559 to HY, Based on the high expression of EGFR in OSCC, a JCYJ20150403091443303 to HY, JCYJ20150403091443286 to YW, and series of targeted therapeutics for EGFR have been SZBC2017023 to YW), and the Sanming Project of Medicine in Shenzhen developed [33, 34]. (SZSM 201512036, Oral and Maxillofacial Surgery Team, Professor Yu Guangyan, Stomatology Hospital Peking University) to Department of Oral Cetuximab is a recombinant human murine chimeric and Maxillofacial Surgery, Peking University Shenzhen Hospital, Shenzhen, IgG1 monoclonal antibody, which has high affinity for Guangdong, China. The funding organization has no role in the design of EGFR, inhibits cell cycle progression, and induces tumor the study, analysis, and interpretation the data and in writing the manuscript. cell apoptosis by specifically binding to the extracellular Availability of data and materials EGFR domain. This reduces the production of MMPs The raw data is available from the authors upon reasonable request. and vascular endothelial growth factors, and inhibits tumor invasion and metastasis. Cetuximab has shown Authors’ contributions WS performed the experiments with help from ML. YW and YS designed the good clinical efficacy and tolerability for EGFR expres- experiments. FW and SS performed the qRT-PCR analysis. YS and HY wrote sion in head and neck cancers [35, 36]. This study found the manuscript, with input from all authors. All authors read and approved that changes in early apoptotic rates is not obvious in the final manuscript. cells after high hsa_circ_0005379 expression in SCC25 Ethics approval and consent to participate and CAL27 cell lines. However, when cetuximab was All patients were informed in accordance with the ethical guidelines of added after overexpressing hsa_circ_0005379 in SCC25 Peking University (Protocol No.37923/2-3-2012). This study was approved by and CAL27 cells, the early apoptotic rate of the cells the Ethics Committee of Peking University Health Science Center (IRB00001053–08043). significantly increased to 38.35 and 35.77%, respectively. This indicates that high hsa_circ_0005379 expression Consent for publication increases cetuximab sensitivity and provides a new poten- Not applicable. tial target for OSCC anticancer drugs design in the future. Competing interests Using software, we also identified possible miRNA The authors declare that they have no competing interests. targets of hsa_circ_0005379, including hsa-miR-145, hsa-miR-182. However, the mechanisms still need to be Publisher’sNote investigated in subsequent experiments. To date, only a Springer Nature remains neutral with regard to jurisdictional claims in few functional circRNAs have been reported in OSCC. published maps and institutional affiliations. Therefore, more effort is needed to elucidate the func- Author details tions and key mechanisms of OSCC-specific circRNAs, Department of Oral and Maxillofacial Surgery, Peking University Shenzhen so that circRNAs can be used effectively in translational Hospital, No. 1120 Lianhua Road, Shenzhen 518001, Guangdong, China. and precision medicine. Peking University Shenzhen Hospital Clinical College, Anhui Medical University, Hefei, Anhui, China. Central laboratory, Peking University Shenzhen Hospital, Shenzhen, Guangdong, China. Conclusions Received: 24 November 2018 Accepted: 9 April 2019 Hsa_circ_0005379 is an OSCC tumor suppressor gene associated with tumor size and differentiation. Upregulation References of hsa_circ_0005379 effectively inhibits migration, invasion, 1. Di PB, Bronson NW, Diggs BS, Jr TC, Hunter JG, Dolan JP. The global burden proliferation of OSCC cells and angiogenesis formation in of esophageal Cancer: a disability-adjusted life-year approach. World J Surg. 2016;40:395–401. https://doi.org/10.1007/s00268-015-3356-2. vitro, and suppresses OSCC growth in nude mice. More- 2. Parkin DM, Bray F, Ferlay J, Pisani P. Global Cancer statistics, 2002. CA Cancer over, hsa_circ_0005379 may be involved in the regulation J Clin. 2009;55:74–108. https://doi.org/10.3322/canjclin.55.2.74. of the EGFR pathway by affecting EGFR expression. 3. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin. 2009;59:225–49. https://doi.org/10.3322/caac.20006. Taken together, our findings provide evidence that 4. Omura K. Current status of oral cancer treatment strategies: surgical hsa_circ_0005379 regulates malignant behavior of OSCC treatments for oral squamous cell carcinoma. Int J Clin Oncol. 2014;19:423– and may be a new therapeutic target for OSCC treatment. 30. https://doi.org/10.1007/s10147-014-0689-z. Su et al. BMC Cancer (2019) 19:400 Page 13 of 13 5. Salzman J, Chen RE, Olsen MN, Wang PL, Brown PO. Cell-type specific 25. Wang Y, Mo Y, Gong Z, Yang X, Yang M, Zhang S, Xiong F, Xiang B, features of circular RNA expression. PLoS Genet. 2013;9:e1003777. https:// Zhou M, Liao Q, Zhang W, Li X, Li X, Li Y, Li G, Zeng Z, Xiong W. doi.org/10.1371/journal.pgen.1003777. Circular RNAs in human cancer. Mol Cancer. 2017;16:25. https://doi.org/ 6. Jeck WR, Sorrentino JA, Wang K, Slevin MK, Burd CE, Liu J, Marzluff WF, 10.1186/s12943-017-0598-7. Sharpless NE. Circular RNAs are abundant, conserved, and associated with 26. Yang Z, Xie L, Han L, Qu X, Yang Y, Zhang Y, He Z, Wang Y, Li J. Circular ALU repeats. RNA N Y N. 2013;19:141–57. https://doi.org/10.1261/rna.035667.112. RNAs: regulators of Cancer-related signaling pathways and potential diagnostic biomarkers for human cancers. Theranostics. 2017;7:3106–17. 7. Rybak-Wolf A, Stottmeister C, Glažar P, Jens M, Pino N, Giusti S, Hanan M, https://doi.org/10.7150/thno.19016. Behm M, Bartok O, Ashwal-Fluss R, Herzog M, Schreyer L, Papavasileiou P, 27. Patop IL, Kadener S. circRNAs in Cancer. Curr Opin Genet Dev. 2018;48:121– Ivanov A, Öhman M, Refojo D, Kadener S, Rajewsky N. Circular RNAs in 7. https://doi.org/10.1016/j.gde.2017.11.007. the mammalian brain are highly abundant, conserved, and dynamically 28. Momen-Heravi F, Bala S. Emerging role of non-coding RNA in oral cancer. expressed. Mol Cell. 2015;58:870–85. https://doi.org/10.1016/j.molcel. Cell Signal. 2018;42:134–43. https://doi.org/10.1016/j.cellsig.2017.10.009. 2015.03.027. 29. Chen L, Zhang S, Wu J, Cui J, Zhong L, Zeng L, Ge S. circRNA_100290 plays 8. Chen Y, Li C, Tan C, Liu X. Circular RNAs: a new frontier in the study of a role in oral cancer by functioning as a sponge of the miR-29 family. human diseases. J Med Genet. 2016;53:359–65. https://doi.org/10.1136/ Oncogene. 2017;36:4551–61. https://doi.org/10.1038/onc.2017.89. jmedgenet-2016-103758. 30. Maron SB, Alpert L, Kwak HA, Lomnicki S, Chase L, Xu D, O’Day E, Nagy RJ, 9. Dong Y, He D, Peng Z, Peng W, Shi W, Wang J, Li B, Zhang C, Duan C. Lanman RB, Cecchi F, Hembrough T, Schrock A, Hart J, Xiao S-Y, Setia N, Circular RNAs in cancer: an emerging key player. J. Hematol. Oncol. 2017;10: Catenacci DVT. Targeted therapies for targeted populations: anti-EGFR 2. https://doi.org/10.1186/s13045-016-0370-2. treatment for EGFR-amplified gastroesophageal adenocarcinoma. Cancer 10. Dou Y, Cha DJ, Franklin JL, Higginbotham JN, Jeppesen DK, Weaver AM, Discov. 2018;8:696–713. https://doi.org/10.1158/2159-8290.CD-17-1260. Prasad N, Levy S, Coffey RJ, Patton JG, Zhang B. Circular RNAs are down- 31. Daizumoto K, Yoshimaru T, Matsushita Y, Fukawa T, Uehara H, Ono M, regulated in KRAS mutant colon cancer cells and can be transferred to Komatsu M, Kanayama H-O, Katagiri T. A DDX31/mutant-p53/EGFR Axis exosomes. Sci Rep. 2016;6:37982. https://doi.org/10.1038/srep37982. promotes multistep progression of muscle-invasive bladder Cancer. Cancer 11. Chen J, Li Y, Zheng Q, Bao C, He J, Chen B, Lyu D, Zheng B, Xu Y, Long Z, Res. 2018;78:2233–47. https://doi.org/10.1158/0008-5472.CAN-17-2528. Zhou Y, Zhu H, Wang Y, He X, Shi Y, Huang S. Circular RNA profile identifies 32. Rubin Grandis J, Melhem MF, Barnes EL, Tweardy DJ. Quantitative circPVT1 as a proliferative factor and prognostic marker in gastric cancer. immunohistochemical analysis of transforming growth factor-alpha and Cancer Lett. 2017;388:208–19. https://doi.org/10.1016/j.canlet.2016.12.006. epidermal growth factor receptor in patients with squamous cell carcinoma 12. Wang Y, Li B, Sun S, Li X, Su W, Wang Z, Wang F, Zhang W, Yang H. of the head and neck. Cancer. 1996;78:1284–92. https://doi.org/10.1002/ Circular RNA expression in Oral squamous cell carcinoma. Front Oncol. (SICI)1097-0142(19960915)78:6<1284::AID-CNCR17>3.0.CO;2-X. 2018;8:398. https://doi.org/10.3389/fonc.2018.00398. 33. Vigneswara V, Kong A. Predictive biomarkers and EGFR inhibitors in 13. Bavle RM, Venugopal R, Konda P, Muniswamappa S, Makarla S. Molecular squamous cell carcinoma of head and neck (SCCHN). Ann Oncol Off J Eur classification of Oral squamous cell carcinoma. J Clin Diagn Res JCDR. 2016; Soc. Med Oncol. 2018;29:794–6. https://doi.org/10.1093/annonc/mdy065. 10:ZE18–21. https://doi.org/10.7860/JCDR/2016/19967.8565. 34. Westover D, Zugazagoitia J, Cho BC, Lovly CM, Paz-Ares L. Mechanisms of 14. Campbell KJ, Tait SWG. Targeting BCL-2 regulated apoptosis in cancer. acquired resistance to first- and second-generation EGFR tyrosine kinase Open Biol. 2018;8. https://doi.org/10.1098/rsob.180002. inhibitors. Ann Oncol Off J Eur Soc Med Oncol. 2018;29:i10–9. https://doi. 15. Liu Z, Ding Y, Ye N, Wild C, Chen H, Zhou J. Direct activation of Bax org/10.1093/annonc/mdx703. protein for Cancer therapy. Med Res Rev. 2016;36:313–41. https://doi. 35. DaiW,LiY,ZhouQ,XuZ,Sun C, TanX, LuL.Cetuximabinhibits Oral org/10.1002/med.21379. squamous cell carcinoma invasion and metastasis via degradation of 16. Jacob A, Jing J, Lee J, Schedin P, Gilbert SM, Peden AA, Junutula JR, Prekeris epidermal growth factor receptor. J Oral Pathol Med Off Publ Int Assoc R. Rab40b regulates trafficking of MMP2 and MMP9 during invadopodia Oral Pathol Am Acad. Oral Pathol. 2014;43:250–7. https://doi.org/10. formation and invasion of breast cancer cells. J Cell Sci. 2013;126:4647–58. 1111/jop.12116. https://doi.org/10.1242/jcs.126573. 36. Naruse T, Yanamoto S, Matsushita Y, Sakamoto Y, Morishita K, Ohba S, 17. Ramos-García P, González-Moles MÁ, González-Ruiz L, Ruiz-Ávila I, Ayén Á, Shiraishi T, Yamada S-I, Asahina I, Umeda M. Cetuximab for the treatment of Gil-Montoya JA. Prognostic and clinicopathological significance of cyclin D1 locally advanced and recurrent/metastatic oral cancer: an investigation of expression in oral squamous cell carcinoma: a systematic review and meta- distant metastasis. Mol Clin Oncol. 2016;5:246–52. https://doi.org/10.3892/ analysis. Oral Oncol. 2018;83:96–106. https://doi.org/10.1016/j.oraloncology. mco.2016.928. 2018.06.007. 18. Zhang Y, Weinberg RA. Epithelial-to-mesenchymal transition in cancer: complexity and opportunities. Front Med. 2018;12:361–73. https://doi.org/ 10.1007/s11684-018-0656-6. 19. Siegel R, Ward E, Brawley O, Jemal A. Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin. 2011;61:212–36. https://doi. org/10.3322/caac.20121. 20. La Vecchia C, Lucchini F, Negri E, Levi F. Trends in oral cancer mortality in Europe. Oral Oncol. 2004;40:433–9. https://doi.org/10.1016/j. oraloncology.2003.09.013. 21. Hammerman PS, Hayes DN, Grandis JR. Therapeutic insights from genomic studies of head and neck squamous cell carcinomas. Cancer Discov. 2015;5: 239–44. https://doi.org/10.1158/2159-8290.CD-14-1205. 22. Plataniotis GA, Theofanopoulou M-E, Kalogera-Fountzila A, Haritanti A, Ciuleanou E, Ghilezan N, Zamboglou N, Dimitriadis A, Sofroniadis I, Fountzilas G. Prognostic impact of tumor volumetry in patients with locally advanced head-and-neck carcinoma (non-nasopharyngeal) treated by radiotherapy alone or combined radiochemotherapy in a randomized trial. Int J Radiat Oncol Biol Phys. 2004;59:1018–26. https://doi.org/10.1016/j. ijrobp.2004.01.021. 23. Salzman J. Circular RNA expression: its potential regulation and function. Trends Genet TIG. 2016;32:309–16. https://doi.org/10.1016/j.tig.2016.03.002. 24. Geng Y, Jiang J, Wu C. Function and clinical significance of circRNAs in solid tumors. J Hematol Oncol. 2018;11:98. https://doi.org/10.1186/ s13045-018-0643-z.

Journal

BMC Cancer – Springer Journals

Published: Apr 29, 2019

Keywords: Oral squamous cell carcinoma; Circular RNAs; EGFR pathway; Cetuximab; Epithelial–mesenchymal transition

There are no references for this article.