Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

RETRACTED ARTICLE: p300 promotes proliferation, migration, and invasion via inducing epithelial-mesenchymal transition in non-small cell lung cancer cells

RETRACTED ARTICLE: p300 promotes proliferation, migration, and invasion via inducing... Background: Histone acetyltransferase p300 is a crucial transcriptional coactivator and has been implicated as a poor prognostic factor in human cancers. However, little is known about the substantial functions and mechanisms of p300 in NSCLC proliferation and distant metastasis. Methods: We constructed p300 down-regulated and up-regulated cell lines through RNAi and recombinant plasmid transfection. Cell Counting Kit-8 assays were used to test the cell proliferation and confirmed by colony formation assays. Wound healing assays and transwell chamber assays were used to test the migration and invasion ability. Based upon these results, we measured the epithelial markers and mesenchymal markers after regulating p300 expression to explore epithelial-mesenchymal transition as a potential mechanism of p300 promoting NSCLC metastasis. Results: In NSCLC cells NCI-H1975 and NCI-H1993, down-regulation of p300 leads to inhibition of cell proliferation and colony formation. Cells with reduced p300 expression also demonstrate inhibited migration and invasion ability. Contrarily, up-regulation of p300 significantly enhanced the proliferation, colony formation, migration and invasion ability of NCI-H460. Importantly, further investigation shows that decreased p300 expression is associated with reduced expression of mesenchymal markers and increased expression of epithelial markers, while up- regulated p300 expression correlated with decreased expression of epithelial markers and increased expression of mesenchymal markers. Conclusions: As a crucial tumor promoter, p300 promotes cell proliferation, migration, and invasion in NSCLC cells. Epithelial-mesenchymal transition is a potential mechanism of p300 promoting NSCLC metastasis. Keywords: Epithelial-mesenchymal transition, Invasion, Non-small cell lung cancer, p300, Prognosis * Correspondence: yanghx@sysucc.org.cn; zhangli@sysucc.org.cn Xue Hou, Run Gong, Jianhua Zhan, Haoxian Yang and Li Zhang contributed equally to this work. Xue Hou, Run Gong and Jianhua Zhan share the first authorship. State Key Laboratory of Oncology in South China, Guangzhou City, Guangdong Province, People’s Republic of China Department of Medical Oncology, Sun Yat-sen University Cancer Center, 651 East Dongfeng Road, 510060 Guangzhou City, Guangdong Province, People’s Republic of China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Hou et al. BMC Cancer (2018) 18:641 Page 2 of 8 Background (ATCC CRL-5803) were obtained from the State Key Non-small cell lung cancer (NSCLC) is the most preva- Laboratory (SKL) of Oncology in South China. These cells lent malignancy and the leading cause of cancer death in grew at 37 °C in a humidified atmosphere of 95% air and the world, with a dismal 5-year survival rate of no more 5% CO2 using Dulbecco’s modified Eagle’smedium sup- than 5% [1, 2]. Despite recent improvements in NSCLC plemented with 10% fetal bovine serum. diagnosis and therapy, most NSCLC patients die of inva- sion and metastasis to the regional lymph nodes and/or Western blot analysis distant organs [3]. Unfortunately, the underlying mech- Western blot analysis of protein expression was per- anism for NSCLC invasion and metastasis remain poorly formed as described previously [20]. Briefly, protein understood. Therefore, improved understanding of the lysates (20 μg) were separated using sodium dodecyl molecular mechanisms underlying NSCLC invasion and sulfate-polyacrylamide gel electrophoresis, and target metastasis is an urgent need for designing effective inter- proteins were detected using Western blotting with anti- ventional strategies and prolonging patient life. bodies against p300 (1:500, Abcam); E-cadherin (1:1000, p300 is a member of the histone acetyltransferase CST); Vimentin (1:1000, CST); Snail (1:500, CST); Fibro- family of transcriptional coactivators. It functions in the nectin (1:100,Merck Millipore); β-catenin (1:1000, CST); transcription process and catalyzes histone acetylation and GAPDH (1:1000, CST). through its histone acetyltransferase activity [4–6]. Fur- thermore, p300 can also acetylize some transcriptional Construction of p300 down-regulated cells factors, such as p53 [7], HIF-1α [8], c-Myb [9], and HEK-293 T cells were seeded in 6 well plates and STAT-1 [10], thus participating in epigenetic regulations grown to 40–60% confluence. According to the man- of some genes involved in DNA repair, cell growth, ufacturer’s instructions, Lenti-sip300 (shp300) and differentiation, and apoptosis. Investigations in breast negative control (shNC) with package vectors were cancer, colorectal cancer, and gastric cancer have identi- transfected into HEK-293 T cells for 72 h. The sequences fied p300 as a tumor suppressor [11, 12]. However, several of the p300 shRNA, which were designed and synthesized studies suggest that p300 promotes cancer progression by the Sigma-Aldrich Company (Shanghai, China), were and that its expression correlates with the tumorigenesis as follows: sense, 5’-CCGGGCCTTCACAATTCCG of several human cancers [13–15]. Over-expression of AGACATCTCGAGATGTCTCGGAATTGTGAAGGC p300 is a poor prognostic factor in breast cancer, prostate TTTTTG-3′, and antisense, 3’-GGCCCGGAAGTGT cancer, hepatocellular carcinoma, and esophageal squa- TAAGGCTCTGTAGAGCTCTACAGAGCCTTAACA mous cell carcinoma [15–18]. Our previous study investi- CTTCCGAAAAAC-5′.The shNC were used as the gated the value of p300 expression in surgically resected control group, and the sequences were as followed: NSCLC patients, and we found that low p300 expression sense, 5’-CCGGGC TTCTCCGAACGTGTCACGTCT was an independent prognostic marker of better survival CGAGATGTCTCGGAATTGTGAAGGCTTTTTG-3′, in operable NSCLC patients [19]. However, the functions and antisense, 3’-GGCCCGAAGAGGCTTGCACAGT and mechanisms of p300 in NSCLC proliferation and GCAGAGCTCTACAGAGCCTTAACACTTCCGAA metastasis need to be investigated comprehensively. AAAC-5′. In this present study, we explored the functions of Lentivirus supernatants were harvested and used to in- p300 in NSCLC proliferation, invasion, and metastasis fect NCI-H1975 cells or NCI-H1993 cells with 2 μg/ml through regulating the p300 expression in vitro. We polybrene for 48 h. The cells were cultured with 2 μg/ml further investigated the gene expressions of epithelial puromycin in the medium for a week, and constructed markers and mesenchymal markers after regulating p300 p300 down-regulated cells H1975/shP300 and H1993/ expression, to explore epithelial-mesenchymal transition shP300, as well as negative control cells H1975/shNC as a potential mechanism of p300 promoting NSCLC and H1993/shNC. metastasis. Methods Construction of p300 up-regulated cells Cell culture and regents NCI-H460 cells were seeded in 6 well plates and This study was approved by the Ethics Committee of grown to 80% confluence before plasmid transfection. Sun Yat-sen University Cancer Center. The human P300-pcDNA3.1-EGFP (P300) or scrambled plasmid NSCLC cell lines NCI-H292 (ATCC CRL-1848), (Vector) was transfected using Lipofectamine 2000 NCI-H460 (ATCC HTB-177), PC-9 (RRID:CVCL_B260), (Invitrogen) as per the manufacturer’sinstructions. A549 (ATCC CCL-185), NCI-H1650 (ATCC CRL-5883), The Lipofectamine- DNA compound was added to cell NCI-H1993 (ATCC CRL-5909), NCI-H1975 (ATCC medium for 6 h and then changed to normal medium. CRL-5908), HCC827 (ATCC CRL-2868), and NCI-H1299 After 48 h, we constructed p300 up-regulated cells H460/ Hou et al. BMC Cancer (2018) 18:641 Page 3 of 8 P300 and control cells H460/Vector, the expression of number of cells was counted under the microscope. Cell P300 was assessed by western blotting. migration was also assessed with wound healing assay. Confluent cells were scraped by 200 μl pipette tip to cre- Cell proliferation assay ate an artificial wound, and incubated in fresh medium Cell proliferation was measured by a Cell Counting containing Mitomycin C (5 μg/ml) for 12 h. Migration Kit-8 (Dojindo, Kumamoto, Japan). Cells were plated in distance was measured by taking pictures at 0 and 12 h. 96-well plates at a density of 2 × 10 cells/mL, main- tained at 37 °C in a humidified atmosphere of 95% air Statistical analysis and 5% CO2. Twenty-four hours later, 10 ul of CCK-8 Mean values of paired data were compared with the solution was added to each well. After incubation for Student t-test. Analysis of variance was used to examine 1 h, the absorbance was determined at 450 nm using a two groups’ data with continuous variables. Categorical microplate reader. data were analyzed with either the Fisher exact or χ2 test. Each experiment was conducted independently at Colony formation assay least three times, and values were presented as the Colony formation assay was performed as described pre- means ± standard error of the mean (SEM) unless other- viously [20]. Briefly, 48 h after shRNA transfection, cells wise stated. The statistical analyses were performed were trypsinized, resuspended as single cells, and plated using the SPSS software program (version 21.0; IBM in 6-well plates with 500 cells per well. After 7–10 days Corporation). Statistical significance was indicated by a of culture, the colonies were fixed with methanol and conventional p value less than 0.05. stained with 1% crystal violet for 10 min. Colonies with more than 50 cells were counted under the microscope. Results Differential expressions of p300 in NSCLC cells Cell invasion assay and wound healing assay We first measured the p300 expression level in nine Invasion assays were performed with Transwell system NSCLC cell lines: NCI-H292, NCI-H460, PC9, A549, (Corning® BioCoat™ Matrigel® Invasion Chambers with NCI-H1650, NCI-H1993, NCI-H1975, HCC827, and 8.0 μm PET Membrane in two 24-well plates). Briefly, NCI-H1299. Western blot analysis demonstrated that 5×10 cells were resuspended in serum-free medium p300 expression was higher in NCI-H1975 and and added to the upper inserts. 750 μl medium supple- NCI-H1993, and lower in HCC827 and NCI-H460 mented with 10% FBS was added in the lower chamber (Fig. 1a). To investigate the role of p300 in NSCLC as a chemoattractant. After incubation for 24–72 h, cells cells, we constructed down- and up-regulated NSCLC migrating to the bottoms of the filters were stained with cells. We used lenti-sip300 (shp300) with package a three-step stain set (Thermo Fisher Scientific), and the vectors to generate p300 down-regulated NSCLC cells Fig. 1 a Relative p300 expression of nine aggressive non-small cell lung cancer cell lines were examined with Western Blot analysis; b NCI-H1975 and NCI-H1993 cells were transfected with shp300 and shNC, western blot was used to determine interference efficiency; c P300-pcDNA3.1-EGFP and scrambled plasmid were transfected into NCI-H460, western blot was used to determine transfection efficiency Hou et al. BMC Cancer (2018) 18:641 Page 4 of 8 H1975/shP300 and H1993/shP300, while negative formation assays on H1975/shP300, H1993/shP300, control (shNC) with package vectors to generate con- and H460/P300 cells as well as control cells. As ex- trol cells H1975/shNC and H1993/shNC (Fig. 1b). We pected, down-regulation of p300 significantly decreased used P300-pcDNA3.1-EGFP to transfect NCI-H460 the clonogenic ability of both cells, clone numbers were cells to generate p300 up-regulated cells H460/P300, 263 ± 37, and 363 ± 16 for H1975/shP300 and H1975/ while scrambled plasmid to generate control cells shNC (p < 0.01), 218 ± 20 and 341 ± 19 for H1993/ H460/Vector (Fig. 1c). shP300 and H1993/shNC, respectively (p < 0.01) (Fig. 2d). Contrarily, up-regulation of p300 increased colony forma- Regulation of p300 affected the proliferation and colony tion of H460, with clone numbers of 196 ± 6 for H460/ formation of NSCLC cells P300 and 56 ± 7 for H460/Vector (p <0.001) (Fig. 2e). We performed a CCK-8 Assay to assess the effect of p300 on NSCLC cell viability. Proliferation was reduced Regulation of p300 affected the migration and invasion in H1975/shP300 compared with H1975/shNC at 48 and of NSCLC cells 72 h (p < 0.0001, both; Fig. 2a). The same result was We evaluated the effects of p300 on cell migration and observed in H1993/shP300 and H1993/shNC (p < 0.001 invasion of NSCLC cells. We first examined the cell at 48 h, p < 0.0001 at 72 h; Fig. 2b). Conversely, prolifer- migration using wound healing assay. H1975/shP300 ation was increased in H460/p300 compared with H460/ demonstrated slower motility (wound closure) compared Vector at 12 and 24 h (p < 0.0001, both; Fig. 2c). To with H1975/shNC (p < 0.01, Fig. 3a), while H460/P300 evaluate a longer-term impact, we performed colony demonstrated increased motility compared with H460/ Fig. 2 Effects of p300 regulation on the proliferation and colony formation of NSCLC cells. a Cell proliferation measured by a Cell Counting Kit-8 Assay were significantly reduced in H1975/shP300 compared with H1975/shNC at 48 and 72 h, p < 0.0001; b Cell proliferation were significantly reduced in H1993/shP300 compared with H1993/shNC at 48 h (p < 0.001) and 72 h (p < 0.0001); c Cell proliferation were significantly increased in H460/P300 compared with H460/Vector at 12 and 24 h, p < 0.0001; d Colony formation assays showed clone numbers were significantly reduced in H1975/shP300 and H1993/shP300 compared with H1975/shNC and H1993/shNC (p < 0.01); e Clone numbers were significantly increased in H460/P300 compared with H460/Vector (p < 0.001) Hou et al. BMC Cancer (2018) 18:641 Page 5 of 8 Fig. 3 Effects of p300 regulation on the migration and invasion ability of NSCLC cells. a Wound healing assay demonstrated that migration distance of H1975/shP300 were smaller than H1975/shNC (p < 0.01); b Wound healing assay demonstrated that migration distance of H460/P300 were larger than H460/Vector (p < 0.001); c Transwell chamber assays demonstrated that invasive cell numbers on the membrane were significantly reduced in H1975/shP300 and H1993/shP300 compared with H1975/shNC and H1993/shNC (p < 0.001); d Transwell chamber assays demonstrated that invasive cell numbers on the membrane were significantly increased in H460/P300 compared with H460/Vector (p < 0.01) Vector (p < 0.001, Fig. 3b). Furthermore, we investigated p300 expression was positively correlated with epithelial- whether regulation of p300 expression would inhibit mesenchymal transition (EMT) NSCLC cell invasion. Transwell chamber assays In order to explore the mechanism of p300 expression showed that transient transfection of p300 shRNA increasing migration and invasion abilities of NSCLC dramatically reduced the invasion of H1975 and cell lines, we measured the levels of EMT-related H1993 cells compared with normal control cells, markers. Compared with normal control cells, increased invasive cell numbers on the membrane were 111 ± expression of epithelial markers E-cadherin, and reduced 26 and 253 ± 24 for H1975/shP300 and H1975/shNC expression of mesenchymal markers Vimentin, and Snail (p < 0.001), 217 ± 35 and 369 ± 9 for H1993/shP300 were demonstrated in H1975/shP300 cells (Fig. 4a), and H1993/shNC, respectively (p < 0.001) (Fig. 3c). while reduced expression of E-cadherin and increased Contrarily, up-regulation of p300 increased the inva- expression of Fibronectin and β-catenin were demon- sion of H460, with invasive cell numbers on the strated in H460/P300 (Fig. 4b). These results suggested membrane of 1028 ± 92 for H460/P300 and 426 ± 33 p300 expression correlated positively with EMT and thus for H460/Vector (p < 0.01, Fig. 3d). promoted cell migration and invasion. Hou et al. BMC Cancer (2018) 18:641 Page 6 of 8 Fig. 4 Effects of p300 regulation on the epithelial and mesenchymal markers expression of NSCLC cells. a Changes of epithelial and mesenchymal markers expression of H1975/shP300 compared with H1975/shNC; b Changes of epithelial and mesenchymal markers expression of H460/P300 compared with H460/Vector Discussion through transfecting P300-pcDNA3.1-EGFP significantly Histone acetyltransferase p300 was found to play an import- enhanced the proliferation, migration and invasion ability ant role in DNA repair, cell growth, differentiation, and of H460. Mechanically, reduced p300 expression corre- apoptosis through epigenetically regulating some transcrip- lated with increased expression of epithelial markers and tional factors; thus much research in recent years has focused decreased expression of mesenchymal markers, while on its function in malignant tumorgenesis and progression up-regulated p300 expression correlated with decreased [11–18]. We previously explored p300 expression in resected expression of epithelial markers and increased expression NSCLC tissues and correlated it with patients’ clinicopatho- of mesenchymal markers, suggesting EMT as a potential logical features as well as survivals. We found that low mechanism of p300 promoting cell migration and inva- expression of p300 was an independent prognostic factor of sion. However, the limitation of our study is that we have better disease-free survival and overall survival in operable not confirmed the conclusion in in vivo experiment, and NSCLC patients [19]. That result was consistent with we will plan it in our future work. findings in other human malignancies, such as esophageal Our findings on p300 function in NSCLC cell lines con- squamous carcinoma [16], prostate cancer [18], and hepato- firm the results of our previous study in resected NSCLC cellular cancer [17], indicating p300 playing an important tissues [19]. Down-regulated p300 leads to inhibited role in tumor progression, although some other studies NSCLC proliferation, migration, and invasion capacity in demonstrated p300 as a tumor suppressor in breast cancer vitro, indicating its role as a promoter in NSCLC progres- [12] and gastric cancer [11]. Based on the above findings, we sion. Consistently, patients with higher expression of p300 designed the current research to comprehensively in- in tumor tissue are at higher risk of distant metastasis and vestigate the functions of p300 in NSCLC cell lines. shorter survival after complete resection, which is inde- In this study, we investigated the function of p300 in pendent of conventional TNM staging system. Integrating NSCLC proliferation, invasion, and metastasis. After our serial findings in vitro and in patients’ clinical out- down-regulating the p300 expression in vitro through comes, the function of p300 has been elucidated in pro- transfecting p300 shRNA into NSCLC cell lines, we moting NSCLC invasion and metastasis. found reduced proliferation in a CCK-8 assay, and The mechanism of p300 promoting cancer progression is significantly decreased clonogenic ability in colony for- attributed to its role as a transcriptional coactivator in pre- mation assay. Furthermore, down-regulation of p300 vious study [7–10]. p300 acetylates histones, weakens their dramatically inhibited cell migration in wound healing interaction with the DNA, loosens the nucleosome, and fa- assay and cell invasion in Transwell chamber assay. Col- cilitates different transcription factors access to the DNA lectively, knockdown of p300 in NSCLC cell lines led to template [21]. By interacting with androgen receptor inhibition of cell proliferation, migration, and invasion. (AR) and activating AR-dependent transcription, p300 Contrarily, up-regulating the p300 expression in vitro promotes AR-dependent prostate cancer progression, Hou et al. BMC Cancer (2018) 18:641 Page 7 of 8 which can be blocked by siRNA against p300 [18, 22]. Abbreviations AR: androgen receptor; CCK-8: Cell Counting Kit-8; EMT: epithelial- p300 also mediates androgen-independent transactivation mesenchymal transition; HAT: histone acetyltransferases; NSCLC: non-small of the AR by IL-6 in AR-independent prostate cancer [23]. cell lung cancer; shRNA: small hairpin RNA; siRNA: small interfering RNA MYC is another proto-oncogene whose transcription is Funding activated by p300, and targeting p300 could repress MYC Design of the study: Chinese National Natural Science Foundation project transcription and thus inhibit cancer cell progression [24]. (81501986); Excellent Young Talent Project of Sun Yat-sen University Cancer Above all, p300 acts as a transcriptional coactivator of Center (04140601). Collection of data: Chinese National Natural Science Foundation project many oncogenes and plays an important role in human (81501986); Excellent Young Talent Project of Sun Yat-sen University Cancer cancers. In our current study, we find interestingly that Center (04140601). EMT might be another mechanism of p300 promoting Analysis of data: Guangdong Provincial Natural Science Foundation project (2016A030313857). NSCLC invasion and metastasis. After down-regulating Writing the manuscript: Guangdong Provincial Medical Science Program p300 expression in NCI-H1975, expressions of epithelial (2016114134515565) . markers E-cadherin, β-catenin were increased, and The funding bodies were not involved in the design of the study, the collection, analysis, and interpretation of data and in writing of the expressions of mesenchymal markers Vimentinand Snail manuscript. were decreased, while up-regulating p300 expression in NCI-H460 correlated with reduced expression of Availability of data and materials The datasets used and/or analysed during the current study are available E-cadherin and increased expression of Fibronectin and from the corresponding author on reasonable request. β-catenin. These changes represent key molecular features of EMT, which was regarded as initial events in the Authors’ contributions XH, HXY and LZ conceived the study, designed, performed and analyzed all process of tumor metastasis. This result demonstrated experiments and wrote the manuscript. RG and JHZ performed all that knockdown of p300 led to loss of mesenchymal experiments. TZ, YXM, YYZ and YXZ participated in cell culture and western phenotype, and acquisition of epithelial phenotype, while blot assays. GC, ZHZ, SXM participated in colony formation assays. XC, FFG, SDH and FL participated in would healing and cell invasion assays. WFF, YPY, up-regulated of p300 led to acquisition of mesenchymal YH and LKC participated in conceiving the study. All authors read and phenotype and loss of epithelial phenotype. This observa- approved the final version of the manuscript. tion explains the results of function research in vitro, and Ethics approval and consent to participate also consistent with our previous study in human NSCLC This study was approved by the Ethics Committee of Sun Yat-sen University tissues, which found that patients with high expression of Cancer Center. p300 were under higher risk of distant metastasis after Competing interests complete resection. Since p300 induces EMT, cancers The authors declare that they have no competing interests. with higher p300 have more potential to detach from pri- mary tumor and metastasis to distant organ. Publisher’sNote Mechanisms of p300 inducing EMT have been studied Springer Nature remains neutral with regard to jurisdictional claims in in other groups. Snail is thought to be a substrate whose published maps and institutional affiliations. histones in promoter could be acetylated by p300 and Author details expression be up-regulated, and thus leads to reduced 1 Department of Medical Oncology, Sun Yat-sen University Cancer Center, 651 expression of E-cadherin [25]. ZEB1 is demonstrated to East Dongfeng Road, 510060 Guangzhou City, Guangdong Province, People’s Republic of China. State Key Laboratory of Oncology in South China, bind p300 and promotes the formation of p300-Smad Guangzhou City, Guangdong Province, People’s Republic of China. transcriptional complex, then activity of ZEB1 is en- 3 Collaborative Innovation Center for Cancer Medicine, Guangzhou City, hanced, synthesis of E-cadherin is reduced, and finally Guangdong Province, People’s Republic of China. Department of Medical Oncology, The Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai City, EMT occurred [26]. Since the current studies of p300 Guangdong, People’s Republic of China. Department of Clinical Research, regulating EMT focus on the transcriptional level, we Sun Yat-sen University Cancer Center, Guangzhou City, Guangdong Province, think it is also necessary to explore the mechanisms People’s Republic of China. Department of Thoracic Oncology, Sun Yat-sen University Cancer Center, 651 East Dongfeng Road, 637300 Guangzhou City, comprehensively on post-transcriptional protein regula- Guangdong, People’s Republic of China. tion, which would be the direction of our future work. Received: 10 October 2017 Accepted: 30 May 2018 Conclusions In this current study, we demonstrate that p300 plays an References important role in proliferation, migration, and invasion of 1. Bender E. Epidemiology: the dominant malignancy. Nat. 2014;513(7517):S2–3. 2. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer NSCLC cells. We further find epithelial-mesenchymal statistics, 2012. CA Cancer J Clin. 2015;65(2):87–108. transition as a novel mechanism underlying the invasive 3. Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, Yu XQ, He J. properties of NSCLC cells with high p300 expression. Cancer statistics in China, 2015. CA Cancer J Clin. 2016;66(2):115–32. 4. Byun JS, Wong MM, Cui W, Idelman G, Li Q, De Siervi A, Bilke S, Haggerty Therefore, targeting p300, or histone acetyltransferases in- CM, Player A, Wang YH, et al. Dynamic bookmarking of primary response hibitors, might be a potential therapeutic strategy for genes by p300 and RNA polymerase II complexes. Proc Natl Acad Sci U S A. blocking NSCLC metastasis. 2009;106(46):19286–91. Hou et al. BMC Cancer (2018) 18:641 Page 8 of 8 5. Guermah M, Palhan VB, Tackett AJ, Chait BT, Roeder RG. Synergistic functions of SII and p300 in productive activator-dependent transcription of chromatin templates. Cell. 2006;125(2):275–86. 6. Turnell AS, Mymryk JS. Roles for the coactivators CBP and p300 and the APC/C E3 ubiquitin ligase in E1A-dependent cell transformation. Br J Cancer. 2006;95(5):555–60. 7. Ferreon JC, Lee CW, Arai M, Martinez-Yamout MA, Dyson HJ, Wright PE. Cooperative regulation of p53 by modulation of ternary complex formation with CBP/p300 and HDM2. Proc Natl Acad Sci U S A. 2009;106(16):6591–6. 8. Ruas JL, Poellinger L, Pereira T. Role of CBP in regulating HIF-1-mediated activation of transcription. J Cell Sci. 2005;118(Pt 2):301–11. 9. Zor T, De Guzman RN, Dyson HJ, Wright PE. Solution structure of the KIX domain of CBP bound to the transactivation domain of c-Myb. J Mol Biol. 2004;337(3):521–34. 10. Wojciak JM, Martinez-Yamout MA, Dyson HJ, Wright PE. Structural basis for recruitment of CBP/p300 coactivators by STAT1 and STAT2 transactivation domains. EMBO J. 2009;28(7):948–58. 11. Koshiishi N, Chong JM, Fukasawa T, Ikeno R, Hayashi Y, Funata N, Nagai H, Miyaki M, Matsumoto Y, Fukayama M. p300 gene alterations in intestinal and diffuse types of gastric carcinoma. Gastric Cancer. 2004;7(2):85–90. 12. Gayther SA, Batley SJ, Linger L, Bannister A, Thorpe K, Chin SF, Daigo Y, Russell P, Wilson A, Sowter HM, et al. Mutations truncating the EP300 acetylase in human cancers. Nat Genet. 2000;24(3):300–3. 13. Fan S, Ma YX, Wang C, Yuan RQ, Meng Q, Wang JA, Erdos M, Goldberg ID, Webb P, Kushner PJ, et al. p300 Modulates the BRCA1 inhibition of estrogen receptor activity. Cancer Res. 2002;62(1):141–51. 14. Bandyopadhyay D, Okan NA, Bales E, Nascimento L, Cole PA, Medrano EE. Down-regulation of p300/CBP histone acetyltransferase activates a senescence checkpoint in human melanocytes. Cancer Res. 2002;62(21):6231–9. 15. Zhang C, Li K, Wei L, Li Z, Yu P, Teng L, Wu K, Zhu J. p300 expression repression by hypermethylation associated with tumour invasion and metastasis in oesophageal squamous cell carcinoma. J Clin Pathol. 2007; 60(11):1249–53. 16. Li Y, Yang HX, Luo RZ, Zhang Y, Li M, Wang X, Jia WH. High expression of p300 has an unfavorable impact on survival in resectable esophageal squamous cell carcinoma. Ann Thorac Surg. 2011;91(5):1531–8. 17. Li M, Luo RZ, Chen JW, Cao Y, Lu JB, He JH, Wu QL, Cai MY. High expression of transcriptional coactivator p300 correlates with aggressive features and poor prognosis of hepatocellular carcinoma. J Transl Med. 2011;9:5. 18. Debes JD, Sebo TJ, Lohse CM, Murphy LM, Haugen DA, Tindall DJ. p300 in prostate cancer proliferation and progression. Cancer Res. 2003;63(22):7638–40. 19. Hou X, Li Y, Luo RZ, Fu JH, He JH, Zhang LJ, Yang HX. High expression of the transcriptional co-activator p300 predicts poor survival in resectable non-small cell lung cancers. Eur J Surg Oncol. 2012;38(6):523–30. 20. Liang Y, Hou X, Cui Q, Kang TB, Fu JH, Zhang LJ, Luo RZ, He JH, Zeng YX, Yang HX. Skp2 expression unfavorably impacts survival in resectable esophageal squamous cell carcinoma. J Transl Med. 2012;10:73. 21. Vo N, Goodman RH. CREB-binding protein and p300 in transcriptional regulation. J Biol Chem. 2001;276(17):13505–8. 22. Ianculescu I, Wu DY, Siegmund KD, Stallcup MR. Selective roles for cAMP response element-binding protein binding protein and p300 protein as coregulators for androgen-regulated gene expression in advanced prostate cancer cells. J Biol Chem. 2012;287(6):4000–13. 23. Debes JD, Schmidt LJ, Huang H, Tindall DJ. p300 mediates androgen- independent transactivation of the androgen receptor by interleukin 6. Cancer Res. 2002;62(20):5632–6. 24. Vervoorts J, Luscher-Firzlaff JM, Rottmann S, Lilischkis R, Walsemann G, Dohmann K, Austen M, Luscher B. Stimulation of c-MYC transcriptional activity and acetylation by recruitment of the cofactor CBP. EMBO Rep. 2003;4(5):484–90. 25. Hsu YL, Huang MS, Yang CJ, Hung JY, Wu LY, Kuo PL. Lung tumor- associated osteoblast-derived bone morphogenetic protein-2 increased epithelial-to-mesenchymal transition of cancer by Runx2/snail signaling pathway. J Biol Chem. 2011;286(43):37335–46. 26. Postigo AA, Depp JL, Taylor JJ, Kroll KL. Regulation of Smad signaling through a differential recruitment of coactivators and corepressors by ZEB proteins. EMBO J. 2003;22(10):2453–62. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Cancer Springer Journals

RETRACTED ARTICLE: p300 promotes proliferation, migration, and invasion via inducing epithelial-mesenchymal transition in non-small cell lung cancer cells

Download PDF
8 pages

Loading next page...
 
/lp/springer-journals/retracted-article-p300-promotes-proliferation-migration-and-invasion-ncnogtZ0VR

References (30)

Publisher
Springer Journals
Copyright
Copyright © The Author(s). 2018
Subject
Biomedicine; Cancer Research; Oncology; Surgical Oncology; Health Promotion and Disease Prevention; Biomedicine, general; Medicine/Public Health, general
eISSN
1471-2407
DOI
10.1186/s12885-018-4559-3
Publisher site
See Article on Publisher Site

Abstract

Background: Histone acetyltransferase p300 is a crucial transcriptional coactivator and has been implicated as a poor prognostic factor in human cancers. However, little is known about the substantial functions and mechanisms of p300 in NSCLC proliferation and distant metastasis. Methods: We constructed p300 down-regulated and up-regulated cell lines through RNAi and recombinant plasmid transfection. Cell Counting Kit-8 assays were used to test the cell proliferation and confirmed by colony formation assays. Wound healing assays and transwell chamber assays were used to test the migration and invasion ability. Based upon these results, we measured the epithelial markers and mesenchymal markers after regulating p300 expression to explore epithelial-mesenchymal transition as a potential mechanism of p300 promoting NSCLC metastasis. Results: In NSCLC cells NCI-H1975 and NCI-H1993, down-regulation of p300 leads to inhibition of cell proliferation and colony formation. Cells with reduced p300 expression also demonstrate inhibited migration and invasion ability. Contrarily, up-regulation of p300 significantly enhanced the proliferation, colony formation, migration and invasion ability of NCI-H460. Importantly, further investigation shows that decreased p300 expression is associated with reduced expression of mesenchymal markers and increased expression of epithelial markers, while up- regulated p300 expression correlated with decreased expression of epithelial markers and increased expression of mesenchymal markers. Conclusions: As a crucial tumor promoter, p300 promotes cell proliferation, migration, and invasion in NSCLC cells. Epithelial-mesenchymal transition is a potential mechanism of p300 promoting NSCLC metastasis. Keywords: Epithelial-mesenchymal transition, Invasion, Non-small cell lung cancer, p300, Prognosis * Correspondence: yanghx@sysucc.org.cn; zhangli@sysucc.org.cn Xue Hou, Run Gong, Jianhua Zhan, Haoxian Yang and Li Zhang contributed equally to this work. Xue Hou, Run Gong and Jianhua Zhan share the first authorship. State Key Laboratory of Oncology in South China, Guangzhou City, Guangdong Province, People’s Republic of China Department of Medical Oncology, Sun Yat-sen University Cancer Center, 651 East Dongfeng Road, 510060 Guangzhou City, Guangdong Province, People’s Republic of China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Hou et al. BMC Cancer (2018) 18:641 Page 2 of 8 Background (ATCC CRL-5803) were obtained from the State Key Non-small cell lung cancer (NSCLC) is the most preva- Laboratory (SKL) of Oncology in South China. These cells lent malignancy and the leading cause of cancer death in grew at 37 °C in a humidified atmosphere of 95% air and the world, with a dismal 5-year survival rate of no more 5% CO2 using Dulbecco’s modified Eagle’smedium sup- than 5% [1, 2]. Despite recent improvements in NSCLC plemented with 10% fetal bovine serum. diagnosis and therapy, most NSCLC patients die of inva- sion and metastasis to the regional lymph nodes and/or Western blot analysis distant organs [3]. Unfortunately, the underlying mech- Western blot analysis of protein expression was per- anism for NSCLC invasion and metastasis remain poorly formed as described previously [20]. Briefly, protein understood. Therefore, improved understanding of the lysates (20 μg) were separated using sodium dodecyl molecular mechanisms underlying NSCLC invasion and sulfate-polyacrylamide gel electrophoresis, and target metastasis is an urgent need for designing effective inter- proteins were detected using Western blotting with anti- ventional strategies and prolonging patient life. bodies against p300 (1:500, Abcam); E-cadherin (1:1000, p300 is a member of the histone acetyltransferase CST); Vimentin (1:1000, CST); Snail (1:500, CST); Fibro- family of transcriptional coactivators. It functions in the nectin (1:100,Merck Millipore); β-catenin (1:1000, CST); transcription process and catalyzes histone acetylation and GAPDH (1:1000, CST). through its histone acetyltransferase activity [4–6]. Fur- thermore, p300 can also acetylize some transcriptional Construction of p300 down-regulated cells factors, such as p53 [7], HIF-1α [8], c-Myb [9], and HEK-293 T cells were seeded in 6 well plates and STAT-1 [10], thus participating in epigenetic regulations grown to 40–60% confluence. According to the man- of some genes involved in DNA repair, cell growth, ufacturer’s instructions, Lenti-sip300 (shp300) and differentiation, and apoptosis. Investigations in breast negative control (shNC) with package vectors were cancer, colorectal cancer, and gastric cancer have identi- transfected into HEK-293 T cells for 72 h. The sequences fied p300 as a tumor suppressor [11, 12]. However, several of the p300 shRNA, which were designed and synthesized studies suggest that p300 promotes cancer progression by the Sigma-Aldrich Company (Shanghai, China), were and that its expression correlates with the tumorigenesis as follows: sense, 5’-CCGGGCCTTCACAATTCCG of several human cancers [13–15]. Over-expression of AGACATCTCGAGATGTCTCGGAATTGTGAAGGC p300 is a poor prognostic factor in breast cancer, prostate TTTTTG-3′, and antisense, 3’-GGCCCGGAAGTGT cancer, hepatocellular carcinoma, and esophageal squa- TAAGGCTCTGTAGAGCTCTACAGAGCCTTAACA mous cell carcinoma [15–18]. Our previous study investi- CTTCCGAAAAAC-5′.The shNC were used as the gated the value of p300 expression in surgically resected control group, and the sequences were as followed: NSCLC patients, and we found that low p300 expression sense, 5’-CCGGGC TTCTCCGAACGTGTCACGTCT was an independent prognostic marker of better survival CGAGATGTCTCGGAATTGTGAAGGCTTTTTG-3′, in operable NSCLC patients [19]. However, the functions and antisense, 3’-GGCCCGAAGAGGCTTGCACAGT and mechanisms of p300 in NSCLC proliferation and GCAGAGCTCTACAGAGCCTTAACACTTCCGAA metastasis need to be investigated comprehensively. AAAC-5′. In this present study, we explored the functions of Lentivirus supernatants were harvested and used to in- p300 in NSCLC proliferation, invasion, and metastasis fect NCI-H1975 cells or NCI-H1993 cells with 2 μg/ml through regulating the p300 expression in vitro. We polybrene for 48 h. The cells were cultured with 2 μg/ml further investigated the gene expressions of epithelial puromycin in the medium for a week, and constructed markers and mesenchymal markers after regulating p300 p300 down-regulated cells H1975/shP300 and H1993/ expression, to explore epithelial-mesenchymal transition shP300, as well as negative control cells H1975/shNC as a potential mechanism of p300 promoting NSCLC and H1993/shNC. metastasis. Methods Construction of p300 up-regulated cells Cell culture and regents NCI-H460 cells were seeded in 6 well plates and This study was approved by the Ethics Committee of grown to 80% confluence before plasmid transfection. Sun Yat-sen University Cancer Center. The human P300-pcDNA3.1-EGFP (P300) or scrambled plasmid NSCLC cell lines NCI-H292 (ATCC CRL-1848), (Vector) was transfected using Lipofectamine 2000 NCI-H460 (ATCC HTB-177), PC-9 (RRID:CVCL_B260), (Invitrogen) as per the manufacturer’sinstructions. A549 (ATCC CCL-185), NCI-H1650 (ATCC CRL-5883), The Lipofectamine- DNA compound was added to cell NCI-H1993 (ATCC CRL-5909), NCI-H1975 (ATCC medium for 6 h and then changed to normal medium. CRL-5908), HCC827 (ATCC CRL-2868), and NCI-H1299 After 48 h, we constructed p300 up-regulated cells H460/ Hou et al. BMC Cancer (2018) 18:641 Page 3 of 8 P300 and control cells H460/Vector, the expression of number of cells was counted under the microscope. Cell P300 was assessed by western blotting. migration was also assessed with wound healing assay. Confluent cells were scraped by 200 μl pipette tip to cre- Cell proliferation assay ate an artificial wound, and incubated in fresh medium Cell proliferation was measured by a Cell Counting containing Mitomycin C (5 μg/ml) for 12 h. Migration Kit-8 (Dojindo, Kumamoto, Japan). Cells were plated in distance was measured by taking pictures at 0 and 12 h. 96-well plates at a density of 2 × 10 cells/mL, main- tained at 37 °C in a humidified atmosphere of 95% air Statistical analysis and 5% CO2. Twenty-four hours later, 10 ul of CCK-8 Mean values of paired data were compared with the solution was added to each well. After incubation for Student t-test. Analysis of variance was used to examine 1 h, the absorbance was determined at 450 nm using a two groups’ data with continuous variables. Categorical microplate reader. data were analyzed with either the Fisher exact or χ2 test. Each experiment was conducted independently at Colony formation assay least three times, and values were presented as the Colony formation assay was performed as described pre- means ± standard error of the mean (SEM) unless other- viously [20]. Briefly, 48 h after shRNA transfection, cells wise stated. The statistical analyses were performed were trypsinized, resuspended as single cells, and plated using the SPSS software program (version 21.0; IBM in 6-well plates with 500 cells per well. After 7–10 days Corporation). Statistical significance was indicated by a of culture, the colonies were fixed with methanol and conventional p value less than 0.05. stained with 1% crystal violet for 10 min. Colonies with more than 50 cells were counted under the microscope. Results Differential expressions of p300 in NSCLC cells Cell invasion assay and wound healing assay We first measured the p300 expression level in nine Invasion assays were performed with Transwell system NSCLC cell lines: NCI-H292, NCI-H460, PC9, A549, (Corning® BioCoat™ Matrigel® Invasion Chambers with NCI-H1650, NCI-H1993, NCI-H1975, HCC827, and 8.0 μm PET Membrane in two 24-well plates). Briefly, NCI-H1299. Western blot analysis demonstrated that 5×10 cells were resuspended in serum-free medium p300 expression was higher in NCI-H1975 and and added to the upper inserts. 750 μl medium supple- NCI-H1993, and lower in HCC827 and NCI-H460 mented with 10% FBS was added in the lower chamber (Fig. 1a). To investigate the role of p300 in NSCLC as a chemoattractant. After incubation for 24–72 h, cells cells, we constructed down- and up-regulated NSCLC migrating to the bottoms of the filters were stained with cells. We used lenti-sip300 (shp300) with package a three-step stain set (Thermo Fisher Scientific), and the vectors to generate p300 down-regulated NSCLC cells Fig. 1 a Relative p300 expression of nine aggressive non-small cell lung cancer cell lines were examined with Western Blot analysis; b NCI-H1975 and NCI-H1993 cells were transfected with shp300 and shNC, western blot was used to determine interference efficiency; c P300-pcDNA3.1-EGFP and scrambled plasmid were transfected into NCI-H460, western blot was used to determine transfection efficiency Hou et al. BMC Cancer (2018) 18:641 Page 4 of 8 H1975/shP300 and H1993/shP300, while negative formation assays on H1975/shP300, H1993/shP300, control (shNC) with package vectors to generate con- and H460/P300 cells as well as control cells. As ex- trol cells H1975/shNC and H1993/shNC (Fig. 1b). We pected, down-regulation of p300 significantly decreased used P300-pcDNA3.1-EGFP to transfect NCI-H460 the clonogenic ability of both cells, clone numbers were cells to generate p300 up-regulated cells H460/P300, 263 ± 37, and 363 ± 16 for H1975/shP300 and H1975/ while scrambled plasmid to generate control cells shNC (p < 0.01), 218 ± 20 and 341 ± 19 for H1993/ H460/Vector (Fig. 1c). shP300 and H1993/shNC, respectively (p < 0.01) (Fig. 2d). Contrarily, up-regulation of p300 increased colony forma- Regulation of p300 affected the proliferation and colony tion of H460, with clone numbers of 196 ± 6 for H460/ formation of NSCLC cells P300 and 56 ± 7 for H460/Vector (p <0.001) (Fig. 2e). We performed a CCK-8 Assay to assess the effect of p300 on NSCLC cell viability. Proliferation was reduced Regulation of p300 affected the migration and invasion in H1975/shP300 compared with H1975/shNC at 48 and of NSCLC cells 72 h (p < 0.0001, both; Fig. 2a). The same result was We evaluated the effects of p300 on cell migration and observed in H1993/shP300 and H1993/shNC (p < 0.001 invasion of NSCLC cells. We first examined the cell at 48 h, p < 0.0001 at 72 h; Fig. 2b). Conversely, prolifer- migration using wound healing assay. H1975/shP300 ation was increased in H460/p300 compared with H460/ demonstrated slower motility (wound closure) compared Vector at 12 and 24 h (p < 0.0001, both; Fig. 2c). To with H1975/shNC (p < 0.01, Fig. 3a), while H460/P300 evaluate a longer-term impact, we performed colony demonstrated increased motility compared with H460/ Fig. 2 Effects of p300 regulation on the proliferation and colony formation of NSCLC cells. a Cell proliferation measured by a Cell Counting Kit-8 Assay were significantly reduced in H1975/shP300 compared with H1975/shNC at 48 and 72 h, p < 0.0001; b Cell proliferation were significantly reduced in H1993/shP300 compared with H1993/shNC at 48 h (p < 0.001) and 72 h (p < 0.0001); c Cell proliferation were significantly increased in H460/P300 compared with H460/Vector at 12 and 24 h, p < 0.0001; d Colony formation assays showed clone numbers were significantly reduced in H1975/shP300 and H1993/shP300 compared with H1975/shNC and H1993/shNC (p < 0.01); e Clone numbers were significantly increased in H460/P300 compared with H460/Vector (p < 0.001) Hou et al. BMC Cancer (2018) 18:641 Page 5 of 8 Fig. 3 Effects of p300 regulation on the migration and invasion ability of NSCLC cells. a Wound healing assay demonstrated that migration distance of H1975/shP300 were smaller than H1975/shNC (p < 0.01); b Wound healing assay demonstrated that migration distance of H460/P300 were larger than H460/Vector (p < 0.001); c Transwell chamber assays demonstrated that invasive cell numbers on the membrane were significantly reduced in H1975/shP300 and H1993/shP300 compared with H1975/shNC and H1993/shNC (p < 0.001); d Transwell chamber assays demonstrated that invasive cell numbers on the membrane were significantly increased in H460/P300 compared with H460/Vector (p < 0.01) Vector (p < 0.001, Fig. 3b). Furthermore, we investigated p300 expression was positively correlated with epithelial- whether regulation of p300 expression would inhibit mesenchymal transition (EMT) NSCLC cell invasion. Transwell chamber assays In order to explore the mechanism of p300 expression showed that transient transfection of p300 shRNA increasing migration and invasion abilities of NSCLC dramatically reduced the invasion of H1975 and cell lines, we measured the levels of EMT-related H1993 cells compared with normal control cells, markers. Compared with normal control cells, increased invasive cell numbers on the membrane were 111 ± expression of epithelial markers E-cadherin, and reduced 26 and 253 ± 24 for H1975/shP300 and H1975/shNC expression of mesenchymal markers Vimentin, and Snail (p < 0.001), 217 ± 35 and 369 ± 9 for H1993/shP300 were demonstrated in H1975/shP300 cells (Fig. 4a), and H1993/shNC, respectively (p < 0.001) (Fig. 3c). while reduced expression of E-cadherin and increased Contrarily, up-regulation of p300 increased the inva- expression of Fibronectin and β-catenin were demon- sion of H460, with invasive cell numbers on the strated in H460/P300 (Fig. 4b). These results suggested membrane of 1028 ± 92 for H460/P300 and 426 ± 33 p300 expression correlated positively with EMT and thus for H460/Vector (p < 0.01, Fig. 3d). promoted cell migration and invasion. Hou et al. BMC Cancer (2018) 18:641 Page 6 of 8 Fig. 4 Effects of p300 regulation on the epithelial and mesenchymal markers expression of NSCLC cells. a Changes of epithelial and mesenchymal markers expression of H1975/shP300 compared with H1975/shNC; b Changes of epithelial and mesenchymal markers expression of H460/P300 compared with H460/Vector Discussion through transfecting P300-pcDNA3.1-EGFP significantly Histone acetyltransferase p300 was found to play an import- enhanced the proliferation, migration and invasion ability ant role in DNA repair, cell growth, differentiation, and of H460. Mechanically, reduced p300 expression corre- apoptosis through epigenetically regulating some transcrip- lated with increased expression of epithelial markers and tional factors; thus much research in recent years has focused decreased expression of mesenchymal markers, while on its function in malignant tumorgenesis and progression up-regulated p300 expression correlated with decreased [11–18]. We previously explored p300 expression in resected expression of epithelial markers and increased expression NSCLC tissues and correlated it with patients’ clinicopatho- of mesenchymal markers, suggesting EMT as a potential logical features as well as survivals. We found that low mechanism of p300 promoting cell migration and inva- expression of p300 was an independent prognostic factor of sion. However, the limitation of our study is that we have better disease-free survival and overall survival in operable not confirmed the conclusion in in vivo experiment, and NSCLC patients [19]. That result was consistent with we will plan it in our future work. findings in other human malignancies, such as esophageal Our findings on p300 function in NSCLC cell lines con- squamous carcinoma [16], prostate cancer [18], and hepato- firm the results of our previous study in resected NSCLC cellular cancer [17], indicating p300 playing an important tissues [19]. Down-regulated p300 leads to inhibited role in tumor progression, although some other studies NSCLC proliferation, migration, and invasion capacity in demonstrated p300 as a tumor suppressor in breast cancer vitro, indicating its role as a promoter in NSCLC progres- [12] and gastric cancer [11]. Based on the above findings, we sion. Consistently, patients with higher expression of p300 designed the current research to comprehensively in- in tumor tissue are at higher risk of distant metastasis and vestigate the functions of p300 in NSCLC cell lines. shorter survival after complete resection, which is inde- In this study, we investigated the function of p300 in pendent of conventional TNM staging system. Integrating NSCLC proliferation, invasion, and metastasis. After our serial findings in vitro and in patients’ clinical out- down-regulating the p300 expression in vitro through comes, the function of p300 has been elucidated in pro- transfecting p300 shRNA into NSCLC cell lines, we moting NSCLC invasion and metastasis. found reduced proliferation in a CCK-8 assay, and The mechanism of p300 promoting cancer progression is significantly decreased clonogenic ability in colony for- attributed to its role as a transcriptional coactivator in pre- mation assay. Furthermore, down-regulation of p300 vious study [7–10]. p300 acetylates histones, weakens their dramatically inhibited cell migration in wound healing interaction with the DNA, loosens the nucleosome, and fa- assay and cell invasion in Transwell chamber assay. Col- cilitates different transcription factors access to the DNA lectively, knockdown of p300 in NSCLC cell lines led to template [21]. By interacting with androgen receptor inhibition of cell proliferation, migration, and invasion. (AR) and activating AR-dependent transcription, p300 Contrarily, up-regulating the p300 expression in vitro promotes AR-dependent prostate cancer progression, Hou et al. BMC Cancer (2018) 18:641 Page 7 of 8 which can be blocked by siRNA against p300 [18, 22]. Abbreviations AR: androgen receptor; CCK-8: Cell Counting Kit-8; EMT: epithelial- p300 also mediates androgen-independent transactivation mesenchymal transition; HAT: histone acetyltransferases; NSCLC: non-small of the AR by IL-6 in AR-independent prostate cancer [23]. cell lung cancer; shRNA: small hairpin RNA; siRNA: small interfering RNA MYC is another proto-oncogene whose transcription is Funding activated by p300, and targeting p300 could repress MYC Design of the study: Chinese National Natural Science Foundation project transcription and thus inhibit cancer cell progression [24]. (81501986); Excellent Young Talent Project of Sun Yat-sen University Cancer Above all, p300 acts as a transcriptional coactivator of Center (04140601). Collection of data: Chinese National Natural Science Foundation project many oncogenes and plays an important role in human (81501986); Excellent Young Talent Project of Sun Yat-sen University Cancer cancers. In our current study, we find interestingly that Center (04140601). EMT might be another mechanism of p300 promoting Analysis of data: Guangdong Provincial Natural Science Foundation project (2016A030313857). NSCLC invasion and metastasis. After down-regulating Writing the manuscript: Guangdong Provincial Medical Science Program p300 expression in NCI-H1975, expressions of epithelial (2016114134515565) . markers E-cadherin, β-catenin were increased, and The funding bodies were not involved in the design of the study, the collection, analysis, and interpretation of data and in writing of the expressions of mesenchymal markers Vimentinand Snail manuscript. were decreased, while up-regulating p300 expression in NCI-H460 correlated with reduced expression of Availability of data and materials The datasets used and/or analysed during the current study are available E-cadherin and increased expression of Fibronectin and from the corresponding author on reasonable request. β-catenin. These changes represent key molecular features of EMT, which was regarded as initial events in the Authors’ contributions XH, HXY and LZ conceived the study, designed, performed and analyzed all process of tumor metastasis. This result demonstrated experiments and wrote the manuscript. RG and JHZ performed all that knockdown of p300 led to loss of mesenchymal experiments. TZ, YXM, YYZ and YXZ participated in cell culture and western phenotype, and acquisition of epithelial phenotype, while blot assays. GC, ZHZ, SXM participated in colony formation assays. XC, FFG, SDH and FL participated in would healing and cell invasion assays. WFF, YPY, up-regulated of p300 led to acquisition of mesenchymal YH and LKC participated in conceiving the study. All authors read and phenotype and loss of epithelial phenotype. This observa- approved the final version of the manuscript. tion explains the results of function research in vitro, and Ethics approval and consent to participate also consistent with our previous study in human NSCLC This study was approved by the Ethics Committee of Sun Yat-sen University tissues, which found that patients with high expression of Cancer Center. p300 were under higher risk of distant metastasis after Competing interests complete resection. Since p300 induces EMT, cancers The authors declare that they have no competing interests. with higher p300 have more potential to detach from pri- mary tumor and metastasis to distant organ. Publisher’sNote Mechanisms of p300 inducing EMT have been studied Springer Nature remains neutral with regard to jurisdictional claims in in other groups. Snail is thought to be a substrate whose published maps and institutional affiliations. histones in promoter could be acetylated by p300 and Author details expression be up-regulated, and thus leads to reduced 1 Department of Medical Oncology, Sun Yat-sen University Cancer Center, 651 expression of E-cadherin [25]. ZEB1 is demonstrated to East Dongfeng Road, 510060 Guangzhou City, Guangdong Province, People’s Republic of China. State Key Laboratory of Oncology in South China, bind p300 and promotes the formation of p300-Smad Guangzhou City, Guangdong Province, People’s Republic of China. transcriptional complex, then activity of ZEB1 is en- 3 Collaborative Innovation Center for Cancer Medicine, Guangzhou City, hanced, synthesis of E-cadherin is reduced, and finally Guangdong Province, People’s Republic of China. Department of Medical Oncology, The Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai City, EMT occurred [26]. Since the current studies of p300 Guangdong, People’s Republic of China. Department of Clinical Research, regulating EMT focus on the transcriptional level, we Sun Yat-sen University Cancer Center, Guangzhou City, Guangdong Province, think it is also necessary to explore the mechanisms People’s Republic of China. Department of Thoracic Oncology, Sun Yat-sen University Cancer Center, 651 East Dongfeng Road, 637300 Guangzhou City, comprehensively on post-transcriptional protein regula- Guangdong, People’s Republic of China. tion, which would be the direction of our future work. Received: 10 October 2017 Accepted: 30 May 2018 Conclusions In this current study, we demonstrate that p300 plays an References important role in proliferation, migration, and invasion of 1. Bender E. Epidemiology: the dominant malignancy. Nat. 2014;513(7517):S2–3. 2. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer NSCLC cells. We further find epithelial-mesenchymal statistics, 2012. CA Cancer J Clin. 2015;65(2):87–108. transition as a novel mechanism underlying the invasive 3. Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, Yu XQ, He J. properties of NSCLC cells with high p300 expression. Cancer statistics in China, 2015. CA Cancer J Clin. 2016;66(2):115–32. 4. Byun JS, Wong MM, Cui W, Idelman G, Li Q, De Siervi A, Bilke S, Haggerty Therefore, targeting p300, or histone acetyltransferases in- CM, Player A, Wang YH, et al. Dynamic bookmarking of primary response hibitors, might be a potential therapeutic strategy for genes by p300 and RNA polymerase II complexes. Proc Natl Acad Sci U S A. blocking NSCLC metastasis. 2009;106(46):19286–91. Hou et al. BMC Cancer (2018) 18:641 Page 8 of 8 5. Guermah M, Palhan VB, Tackett AJ, Chait BT, Roeder RG. Synergistic functions of SII and p300 in productive activator-dependent transcription of chromatin templates. Cell. 2006;125(2):275–86. 6. Turnell AS, Mymryk JS. Roles for the coactivators CBP and p300 and the APC/C E3 ubiquitin ligase in E1A-dependent cell transformation. Br J Cancer. 2006;95(5):555–60. 7. Ferreon JC, Lee CW, Arai M, Martinez-Yamout MA, Dyson HJ, Wright PE. Cooperative regulation of p53 by modulation of ternary complex formation with CBP/p300 and HDM2. Proc Natl Acad Sci U S A. 2009;106(16):6591–6. 8. Ruas JL, Poellinger L, Pereira T. Role of CBP in regulating HIF-1-mediated activation of transcription. J Cell Sci. 2005;118(Pt 2):301–11. 9. Zor T, De Guzman RN, Dyson HJ, Wright PE. Solution structure of the KIX domain of CBP bound to the transactivation domain of c-Myb. J Mol Biol. 2004;337(3):521–34. 10. Wojciak JM, Martinez-Yamout MA, Dyson HJ, Wright PE. Structural basis for recruitment of CBP/p300 coactivators by STAT1 and STAT2 transactivation domains. EMBO J. 2009;28(7):948–58. 11. Koshiishi N, Chong JM, Fukasawa T, Ikeno R, Hayashi Y, Funata N, Nagai H, Miyaki M, Matsumoto Y, Fukayama M. p300 gene alterations in intestinal and diffuse types of gastric carcinoma. Gastric Cancer. 2004;7(2):85–90. 12. Gayther SA, Batley SJ, Linger L, Bannister A, Thorpe K, Chin SF, Daigo Y, Russell P, Wilson A, Sowter HM, et al. Mutations truncating the EP300 acetylase in human cancers. Nat Genet. 2000;24(3):300–3. 13. Fan S, Ma YX, Wang C, Yuan RQ, Meng Q, Wang JA, Erdos M, Goldberg ID, Webb P, Kushner PJ, et al. p300 Modulates the BRCA1 inhibition of estrogen receptor activity. Cancer Res. 2002;62(1):141–51. 14. Bandyopadhyay D, Okan NA, Bales E, Nascimento L, Cole PA, Medrano EE. Down-regulation of p300/CBP histone acetyltransferase activates a senescence checkpoint in human melanocytes. Cancer Res. 2002;62(21):6231–9. 15. Zhang C, Li K, Wei L, Li Z, Yu P, Teng L, Wu K, Zhu J. p300 expression repression by hypermethylation associated with tumour invasion and metastasis in oesophageal squamous cell carcinoma. J Clin Pathol. 2007; 60(11):1249–53. 16. Li Y, Yang HX, Luo RZ, Zhang Y, Li M, Wang X, Jia WH. High expression of p300 has an unfavorable impact on survival in resectable esophageal squamous cell carcinoma. Ann Thorac Surg. 2011;91(5):1531–8. 17. Li M, Luo RZ, Chen JW, Cao Y, Lu JB, He JH, Wu QL, Cai MY. High expression of transcriptional coactivator p300 correlates with aggressive features and poor prognosis of hepatocellular carcinoma. J Transl Med. 2011;9:5. 18. Debes JD, Sebo TJ, Lohse CM, Murphy LM, Haugen DA, Tindall DJ. p300 in prostate cancer proliferation and progression. Cancer Res. 2003;63(22):7638–40. 19. Hou X, Li Y, Luo RZ, Fu JH, He JH, Zhang LJ, Yang HX. High expression of the transcriptional co-activator p300 predicts poor survival in resectable non-small cell lung cancers. Eur J Surg Oncol. 2012;38(6):523–30. 20. Liang Y, Hou X, Cui Q, Kang TB, Fu JH, Zhang LJ, Luo RZ, He JH, Zeng YX, Yang HX. Skp2 expression unfavorably impacts survival in resectable esophageal squamous cell carcinoma. J Transl Med. 2012;10:73. 21. Vo N, Goodman RH. CREB-binding protein and p300 in transcriptional regulation. J Biol Chem. 2001;276(17):13505–8. 22. Ianculescu I, Wu DY, Siegmund KD, Stallcup MR. Selective roles for cAMP response element-binding protein binding protein and p300 protein as coregulators for androgen-regulated gene expression in advanced prostate cancer cells. J Biol Chem. 2012;287(6):4000–13. 23. Debes JD, Schmidt LJ, Huang H, Tindall DJ. p300 mediates androgen- independent transactivation of the androgen receptor by interleukin 6. Cancer Res. 2002;62(20):5632–6. 24. Vervoorts J, Luscher-Firzlaff JM, Rottmann S, Lilischkis R, Walsemann G, Dohmann K, Austen M, Luscher B. Stimulation of c-MYC transcriptional activity and acetylation by recruitment of the cofactor CBP. EMBO Rep. 2003;4(5):484–90. 25. Hsu YL, Huang MS, Yang CJ, Hung JY, Wu LY, Kuo PL. Lung tumor- associated osteoblast-derived bone morphogenetic protein-2 increased epithelial-to-mesenchymal transition of cancer by Runx2/snail signaling pathway. J Biol Chem. 2011;286(43):37335–46. 26. Postigo AA, Depp JL, Taylor JJ, Kroll KL. Regulation of Smad signaling through a differential recruitment of coactivators and corepressors by ZEB proteins. EMBO J. 2003;22(10):2453–62.

Journal

BMC Cancer – Springer Journals

Published: Jun 7, 2018

Keywords: Epithelial-mesenchymal transition; Invasion; Non-small cell lung cancer; p300; Prognosis

There are no references for this article.