Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Rumen-protected methionine during the peripartal period in dairy cows and its effects on abundance of major species of ruminal bacteria

Rumen-protected methionine during the peripartal period in dairy cows and its effects on... Background: Extensive degradation of amino acids in the rumen via microbial deamination decreases the post- ruminal availability of dietary indispensable amino acids. Together with the normal decrease in voluntary dry matter intake (DMI) around parturition in dairy cows, microbial metabolism contributes to a markedly negative balance of indispensable amino acids, including methionine which may be the first-limiting for milk production. The main objective of the current study was to profile changes in major bacterial species with key functions in cellulose and hemicellulose digestion, xylan breakdown, proteolytic action, propionic acid production, lactate utilization and ruminal biohydrogenation in cows supplemented with rumen-protected Methionine (SM; Smartamine M, Adisseo NA, Alpharetta, GA, USA) from −23 through 30 d relative to parturition. Because ~90% of the methionine in SM bypasses the rumen, ~10% of the methionine is released into the rumen and can be utilized by microbes. Results: As expected, there was an increase in overall DMI after parturition (Day, P < 0.05) during which cows consumed on average 19.6 kg/d versus 13.9 kg/d in the prepartum period. The postpartum diet contained greater concentrations of lipid and highly-fermentable carbohydrate from corn grain, which likely explains the increases in the relative abundance of Anaerovibrio lipolytica, Megasphaera elsdenii, Prevotella bryantii, Selenomonas ruminantium, Streptococcus bovis,and Succinimonas amylolytica. Despite similar DMI prepartum, cows fed SM had greater (Treatment × Day, P < 0.05) abundance prepartum of Fibrobacter succinogenes, Succinimonas amylolytica,and Succinivibrio dextrinosolvens. However, the greater DMI in cows fed SM after parturition (19.6 kg/d versus 13.9 kg/d) was −3 −4 associated with lower abundance of Fibrobacter succinogenes (2.13 × 10 versus 2.25 × 10 )and Selenomonas −1 −1 ruminantium (2.98 × 10 versus 4.10 × 10 ). A lower abundance (Day, P < 0.05) was detected on d 20 compared with d −10 for Fibrobacter succinogenes and Succinivibrio dextrinosolvens. The relative abundance of Butyrivibrio proteoclasticus and Eubacterium ruminantium was stable across treatment and time. (Continued on next page) * Correspondence: jloor@illinois.edu Department of Animal Sciences, Mammalian NutriPhysioGenomics, University of Illinois, Urbana, IL 61801, USA Division of Nutritional Sciences, Illinois Informatics Institute, University of Illinois, Urbana, IL, USA Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 2 of 7 (Continued from previous page) Conclusions: In diets with proper balance of rumen-degradable protein and fermentable carbohydrate, the small fraction of Methionine released from the rumen-protected supplement did not seem to compromise growth of major bacterial species in the rumen. In fact, it had a positive effect on 3 major species prepartum when DMI was similar between groups. Because the actual requirements of Methionine (and Lysine, for example) by the cow during the transition period are unknown, it appears warranted to study the rumen microbiome as it relates to supply of rumen-protected amino acids. Keywords: Microbiome, Rumen microbes, Transition cow Background species with key functions in cellulose and hemicellulose Extensive degradation of amino acids in the rumen [1] via digestion, xylan breakdown, proteolytic action, propionic microbial deamination [2, 3] substantially lowers the post- acid production, lactate utilization and ruminal biohydro- ruminal availability of dietary indispensable amino acids genation in cows supplemented with RPM (Smartamine (IAA). Together with the normal decrease in voluntary dry M, Adisseo NA, Alpharetta, GA) from −23 through 30 d matter intake (DMI) around parturition in dairy cows, around parturition. Smartamine M is designed to release microbial metabolism contributes to a markedly negative over 90% of the methionine along the small intestine. balance of IAA, including methionine which often is the Thus, the remaining 10% of the methionine is released first-limiting amino acid [4]. Therefore, the importance of into the rumen and can be utilized by microbes. Hence, enhancing the delivery methionine to the small intestine the hypothesis was that the liberated methionine portion through “rumen by-pass” technologies has been under- into the rumen following dietary RPM supplementation scored since the early 1960’s [5]. The physiologic impact of could affect the composition of major ruminal bacteria supplementing dairy diets with rumen-protected methio- around calving. nine (RPM) at lactation stages where needs are the greatest has received close attention worldwide, i.e. improving the Methods overall health, metabolism, and production performance Animal handling and all procedures of this study received in dairy cows [6–9]. With the advances in methionine pro- approval from the Institutional Animal Care and Use tection technology, a large proportion of protected me- Committee of the University of Illinois under protocol no. thionine escapes ruminal degradation but a small fraction 13023. In total, a subset of 20 multiparous cows from a of methionine is still released into the rumen and may larger study [16] were randomly selected for ruminal fluid change the community composition of the rumen micro- sampling. These cows were either fed a control diet with- biota and their metabolism. out RPM (CON) or CON plus RPM supplementation During the peripartal period, dairy cow diets move from (SM) at a rate of 0.08% of DMI (Smartamine M, Adisseo higher-forage content before calving to higher-concentrate NA, Alpharetta, GA). Dosage of RPM was based on previ- diets postpartum to provide the rumen microbial communi- ous work from our research group [17]. At the start of the ties with more readily-available energy. As a result, microbial experimental feeding phase, none of the cows enrolled composition changes in favor of generating more volatile had received any type of RPM. All cows received a far-off fatty acids (VFA) and microbial protein to serve as a fuel and diet (Table 1) as total mixed ration (TMR) from −50 to amino acid sources, respectively, for body tissues and milk −22 d before expected calving date (1.40 Mcal/kg of DM, synthesis [10–12]. Therefore, nutritional management plays a 10.2% rumen-degradable protein, and 4.1% rumen- key role in shaping the microbial ecosystem in the rumen undegradable protein), a close-up diet from −21 d to the [13, 14]. Despite the continued focus on nutritional manage- expected calving date (1.52 Mcal/ kg of DM, 9.1% rumen- ment of peripartal cows, little is known about the response degradable protein, and 5.4% rumen-undegradable pro- of rumen microbes to methionine supplementation. For ex- tein) and a lactation diet after calving through 30 d post- ample, Salsbury et al. [15] and Gil et al. [3] were among the partum (1.71 Mcal/kg of DM, 9.7% rumen-degradable first to observe that unprotected supplemental methionine protein, and 7.5% rumen-undegradable protein). The enhanced ruminal bacteria growth rate and protein synthesis TMR was delivered once daily (0600 h) using an electronic in vitro. recognition feeding system for each cow (American Calan, Although there is growing evidence that RPM enhances Northwood, NH) before calving or in open individual overall dairy cow health and productivity, whether ruminal mangers during lactation. The DM content of the TMR bacteria composition changes in response to RPM supple- for the close-up and lactation diets was measured weekly mentation remains unknown. Therefore, the objective of for estimation of daily TMR dry matter offered. The re- the current study was to profile changes in major bacterial quired amount of RPM was calculated daily for each Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 3 of 7 Table 1 Ingredients and chemical composition of experimental Ruminal bacteria DNA isolation and qPCR amplification of diets 16S rDNA genes Diet At −10 d before expected calving date and d 20 postpar- tum, ruminal fluid was sampled from each cow using a Ingredient, Far-off Close-up Lactation %ofDM stomach tube prior to the morning feeding. The sample Alfalfa silage 12.00 8.34 5.07 was filtered through three layers of cheesecloth. Mixed ru- minal fluid was immediately frozen in liquid nitrogen Alfalfa hay – 4.29 2.98 followed by storage at −80 °C. Total genomic DNA was iso- Corn silage 33.00 36.40 33.41 lated using the repeated bead beating method described by Wheat straw 36.00 15.63 2.98 Yu and Morrison [18] for mechanical lysis of bacterial cell Cottonseed –– 3.58 wall, employing the QIAamp DNA mini kit (QIAGEN) for Wet brewers – 4.29 9.09 DNA purification. The DNA quantity and quality were grains checked by 0.8% (wt/v) agarose gel electrophoresis and Ground shelled 4.00 12.86 23.87 NanoDrop spectrophotometer (ND 1000, NanoDrop corn Technologies, Inc., Wilmington, DE, USA) at 260 nm. Ex- Soy hulls 2.00 4.29 4.18 tracted DNA was standardized to 8 ng/μLfor qPCR. Soybean meal, 7.92 2.57 2.39 The primer sets selected to amplify 10 targeted rumen 48% CP bacterial species are listed in Table 2 and were validated Expeller soybean – 2.57 5.97 using gel electrophoresis. A total of 10 μL of qPCR mix- meal ture contained 4 μLsample DNA, 5 μL1× SYBR Green Soychlor 0.15 3.86 – with ROX (Quanta BioSciences, Gaithersburg, MD, USA), Blood meal, 85% 1.00 –– 0.4 μLeach of 10 μmol/L forward and reverse primers, CP and 0.2 μL DNase/RNase free water in a MicroAmp™ Op- ProVAAl AADvantage – 0.86 1.50 tical 384-Well Reaction Plate (Applied Biosystems, Foster Urea 0.45 0.30 0.18 City, CA, USA). Negative controls without template DNA, Rumen-inert fat –– 1.02 standards, and samples were run on the same plate in trip- licate. The qPCR reactions were performed with the ABI Limestone 1.30 1.29 1.31 Prism 7900HT Fast Real-Time PCR System (Applied Bio- Salt 0.32 0.30 0.30 systems, Foster City, CA, USA) using the following pro- Dicalcium phosphate 0.12 0.18 0.30 gram: initial denaturation at 95 °C for 5 min, followed by Magnesium oxide 0.21 0.08 0.12 40 cycles of 1 s at 95 °C and 30 s annealing at 60 °C, ex- Magnesium sulfate 0.91 0.99 – cept for eubacterial primer 3 that required an annealing Sodium bicarbonate –– 0.79 temperature of 56 °C. A dissociation stage was performed to determine the specificity of the amplification. Relative Potassium carbonate –– 0.30 abundance of bacterial species was calculated using the Calcium sulfate –– 0.12 geometric mean of two universal primers [19, 20] with the Mineral vitamin mix 0.20 0.17 0.18 −CT efficiency-corrected Δ method [21]. Thus, the abun- Vitamin A 0.015 –– dance of each target bacteria was determined relative to Vitamin D 0.025 –– the overall abundance of the total bacteria as measured Vitamin E 0.38 0.39 – with the universal primers. Biotin – 0.35 0.35 a Statistical analysis SoyPLUS (West Central Soy, Ralston, IA) By West Central Soy Drymatterintakeand relative abundanceof bacteriawere Perdue AgSolutions LLC (Ansonia, OH) analyzed using the MIXED procedure of SAS 9.3 (SAS Inst. Energy Booster 100 (Milk Specialties Global, Eden Prairie, MN) Inc., Cary, NC, USA). The fixed effects in the model were Contained a minimum of 5% Mg, 10% S, 7.5% K, 2.0% Fe, 3.0% Zn, 3.0% Mn, 5,000 mg of Cu/kg, 250 mg of I/kg, 40 mg of Co/kg, Day, Treatment, and the interaction of Day × Treatment. 150 mg of Se/kg, 2,200 kIU of vitamin A/kg, 660 kIU of vitamin The random effect was cow within treatment. D /kg, and 7,700 IU of vitamin E/kg Contained 30,000 kIU/kg Contained 5,009 kIU/kg Results Contained 44,000 kIU/kg Dry matter intake individual cow and was top-dressed from −21 ± 2 to As expected, there was an increase in overall DMI after 30 d relative to parturition once daily at the morning parturition (Day, P < 0.05) during which cows consumed feeding using approximately 50 g of ground corn as on average 19.6 kg/d versus 13.9 kg/d in the prepartum carrier. period. The overall effect of treatment (P < 0.05) was due Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 4 of 7 Table 2 Species-specific primers for the quantification of selected rumen bacterial populations using a real-time qPCR assay Target bacterial Primer sequence Reference species (5' → 3') Anaerovibrio lipolytica F: GAAATGGATTCTAGTGGCAAACG [12] R: ACATCGGTCATGCGACCAA Butyrivibrio proteoclasticus F: GGGCTTGCTTTGGAAACTGTT [12] R: CCCACCGATGTTCCTCCTAA Eubacterium ruminantium F: CTCCCGAGACTGAGGAAGCTTG [37] R: GTCCATCTCACACCACCGGA Fibrobacter succinogenes F: GCGGGTAGCAAACAGGATTAGA [37] R: CCCCCGGACACCCAGTAT Megaspheara elsdenii F: AGATGGGGACAACAGCTGGA [37] R: CGAAAGCTCCGAAGAGCCT Prevotella bryantii F: AGCGCAGGCCGTTTGG [37] R: GCTTCCTGTGCACTCAAGTCTGAC Selenomonas ruminantium F: CAATAAGCATTCCGCCTGGG [37] R: TTCACTCAATGTCAAGCCCTGG Succinimonas amylolytica F: CGTTGGGCGGTCATTTGAAAC [29] R: CCTGAGCGTCAGTTACTATCCAGA Streptococcus bovis F: TTCCTAGAGATAGGAAGTTTCTTCGG [37] R: ATGATGGCAACTAACAATAGGGGT Succinivibrio dextrinosolvens F: TAGGAGCTTGTGCGATAGTATGG [29] R: CTCACTATGTCAAGGTCAGGTAAGG Bacteria general 1 F: GGATTAGATACCCTGGTAGT [20] R: CACGACACGAGCTGACG Bacteria general 2 F: GTGSTGCAYGGYTGTCGTCA [19] R: ACGTCRTCCMCACCTTCCTC a b F forward primer; R reverse primer to cows in the SM group consuming ~3 kg DM more than those in the CON group specifically after partur- ition (Fig. 1; 19.6 kg/d versus 13.9 kg/d). CON SM a Abundance of ruminal bacteria The relative abundance of target bacterial species is pre- 20 b sented in Table 3. Selenomonas ruminantium was the only bacterial species with an overall treatment effect (P = 0.01) due to a 27.4% decrease in abundance with SM supplementation. Furthermore, this was the most- −1 abundant bacterial species ranging from 2.63×10 at −1 5 −10 d (SM) to 6.39×10 (a peak in abundance) at 20 d in cows fed CON. Concerning day effects, greater relative abundance of -10 20 Fibrobacter succinogenes (P < 0.01) and Succinivibrio dex- Day relative to parturition trinosolvens (P = 0.05) was observed at −10 d compared Fig. 1 Dry matter intake in Holstein cows fed a control diet (CON) or with 20 d postpartum. Furthermore, there was a day effect CON supplemented with rumen-protected methionine (SM) from d ab (P < 0.01) for Anaerovibrio lipolytica, Megasphaera elsde- −21 through d 30 relative to parturition. Different letters denote treatment effects (P < 0.05) between treatments. The P value for the nii, Prevotella bryantii, Selenomonas ruminantium and overall effect of Treatment, Day, and Treatment × Day was 0.002, 0.03, Streptococcus bovis (P = 0.02) as these bacterial species and 0.48, respectively. Bars indicate standard error of the means had greater abundance at 20 d compared with −10 d Dry matter intake, kg/d Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 5 of 7 Table 3 Relative abundance of microbial species in mixed ruminal fluid from Holstein cows fed a control diet (CON) or CON supplemented with rumen-protected methionine (SM) during the periparturient period Day × Treatment Treatment Day CON SM P value Species CON SM −10 20 −10 20 −10 20 Trt Day T × D −3 −3 -3b -3a −3 −3 −3 −3 A. lipolytica 3.28×10 3.42×10 2.50×10 4.48×10 2.25×10 4.77×10 2.77×10 4.21×10 0.82 <0.01 0.42 −2 −3 −2 −3 −2 −3 −3 −3 B. proteoclasticus 1.07×10 8.88×10 1.01×10 9.46×10 1.24×10 9.29×10 8.18×10 9.64×10 0.20 0.67 0.13 −2 −2 −2 −2 −2 −2 −2 −2 E. ruminantium 2.44×10 2.45×10 2.23×10 2.69×10 2.59×10 2.31×10 1.92×10 3.13×10 0.98 0.38 0.16 −4 −4 -3a -4b -4B -4B -3A -4C F. succinogenes 7.10×10 6.93×10 1.16×10 4.25×10 6.29×10 8.02×10 2.13×10 2.25×10 0.92 <0.01 <0.01 −5 −5 -6b -4a −6 −4 −6 −4 M. elsdenii 3.90×10 1.90×10 2.40×10 2.34×10 4.60×10 2.07×10 1.00×10 2.65×10 0.43 <0.01 0.24 −3 −3 -4b -3a −3 −2 −4 −3 P. bryantii 4.22×10 1.30×10 7.61×10 7.20×10 1.12×10 1.60×10 5.19×10 3.25×10 0.12 <0.01 0.57 -1a -1b -1b -1a -1C -1A -1C -1BC S. ruminantium 4.10×10 2.98×10 2.63×10 4.65×10 2.63×10 6.39×10 2.63×10 3.37×10 0.01 <0.01 0.01 −4 −4 −4 −5 -5B -4B -4A -5B S. amylolytica 1.02×10 2.30×10 2.51×10 9.40×10 9.90×10 1.05×10 6.32×10 8.40×10 0.16 0.07 0.05 −5 −4 -4a -5b -5B -4B -4A -5B S. dextrinosolvens 9.10×10 1.60×10 1.71×10 8.50×10 8.10×10 1.02×10 3.64×10 7.00×10 0.10 0.05 0.01 −3 −3 -3b -3a −3 −3 −3 −3 S. bovis 8.09×10 3.50×10 3.17×10 8.93×10 6.68×10 9.79×10 1.51×10 8.14×10 0.22 0.02 0.14 Trt treatment effect, Day day effect, T×D Treatment by Day interaction ab Means for overall Treatment or Day effect differ (P < 0.05) A-C Means for the interaction of Day × Treatment differ (P < 0.05) around parturition. Succinimonas amylolytica tended to this species or increased the diversity of the rumen be greater (P =0.07) at −10 compared with 20 d. population. The relative abundance of Butyrivibrio proteoclasticus Availability of propionate for gluconeogenesis by the and Eubacterium ruminantium was stable (P > 0.05) across animal during the transition into lactation relies heavily treatment and time. However, Eubacterium ruminantium on both Selenomonas ruminantium and Megasphaera was the second most-abundant bacterial species among elsdenii numbers in the rumen [25]. Approximately 90% −2 those studied, ranging from 1.92×10 at −10 d with SM of glucose in ruminants is supplied by gluconeogenesis, −2 to 3.13×10 at 20 d also with SM. with 50 to 60% of this being derived from propionate A Day × Treatment interaction was observed for Fibro- [26]. Thus, the longitudinal change in Selenomonas bacter succinogenes, Selenomonas ruminantium, Succinivi- ruminantium and Megasphaera elsdenii agrees with brio dextrinosolvens, and S. amylolytica. Selenomonas higher content of rapidly-fermentable carbohydrate in ruminantium abundance nearly doubled (P = 0.01) between the postpartum diet, i.e. substrate availability likely −10 and 20 d only in CON cows. In contrast, Fibrobacter helped enhance the numbers of these species [23]. succinogenes, Succinimonas amylolytica and Succinivibrio Except for Butyrivibrio proteoclasticus (fibrolytic spe- dextrinosolvens decreased on d 20 in SM cows while no cies), the greater numbers of Anaerovibrio lipolytica, change or a decrease was observed in CON cows. Prevotella bryantii, Megasphaera elsdenii, Selenomonas ruminantium, and Streptococcus bovis at d 20 postpar- Discussion tum along with the lower numbers of Fibrobacter succi- Selenomonas ruminantium was the most abundant bac- nogenes, Succinimonas amylolytica, and Succinivibrio terial species observed in the present study and agrees dextrinosolvens were consistent with a previous study with previous classical studies indicating that this Gram- [12]. They attributed these changes to the important fea- negative bacteria could account for up to 51% of the tures associated with the transition into lactation, e.g. total viable bacterial counts within the rumen [22]. The greater concentration of lipid and rapidly-fermentable fact that Selenomonas ruminantium was overall 27.4% carbohydrate as a way to provide more energy for the lower in response to RPM supplementation could have cow during a period when voluntary DMI may be less been associated with the greater DMI in those cows after than optimal. parturition. This microbial species is a propionate- Thefactthatabundance of Streptococcus bovis and Pre- producer through decarboxylation of succinate, which votella bryantii at 20 d postpartum was associated with involves lactic acid production particularly during feed- greater abundance of Selenomonas ruminantium and ing of higher-concentrate diets [23, 24]. Thus, because Megasphaera elsdenii seems to indicate some degree of the numbers of Selenomonas ruminantium in SM-fed synchronization. These results are broadly consistent with cows actually increased numerically after parturition other studies demonstrating that, as dietary grain in- relative to the prepartum period, it is likely that the creases, the prevalence of starch-fermenting bacteria like greater DMI in those cows either diluted the numbers of Streptococcus bovis is increased with a consequent Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 6 of 7 synchronized increase in the population ratio of lactate- Clearly, the diets used in the present study appear to consuming bacteria like Selenomonas ruminantium and have provided enough fermentable energy and nitrogen Megasphaera elsdenii to help eliminate lactate via fermen- sources to allow normal growth of the major microbes tation to propionate [25, 27–29]. Prevotella spp. grows studied. Whether the rumen microbiome responds to rapidly on starch and produce succinate and propionate the supply of rumen-protected supplements needs to be as major end-products [29, 30]. A previous study [12] at- explored further. This is particularly important because tributed a higher proportion of Megasphaera elsdenii and the actual requirements of methionine (and lysine, for Prevotella bryantii after parturition to the higher DMI, example) during the transition period are unknown. which agrees with data in the present study. The lower abundance of Fibrobacter succinogenes post- Conclusions partum was associated with greater abundance of Anae- In diets with proper balance of rumen-degradable pro- rovibrio lipolytica and seems to be partly explained by a tein and fermentable carbohydrate, the small fraction of potential negative effect of higher availability of dietary Methionine released from the rumen-protected supple- unsaturated fatty acids on ruminal cellulolytic bacteria ment did not seem to compromise growth of major bac- [31]. Indirectly, these results suggest that the greater terial species in the rumen. In fact, it had a positive fiber content of the prepartum diet allowed for greater effect on 3 major species prepartum when DMI was numbers of Fibrobacter succinogenes, which agrees with similar between groups. Because the actual requirements a previous study [25]. In ruminants fed high-forage diets of Methionine (and Lysine, for example) by the cow dur- Fibrobacter succinogenes is one of the predominant cel- ing the transition period are unknown, it appears war- lulolytic species, favoring the greater production of acet- ranted to study the rumen microbiome as it relates to ate relative to propionate [32]. supply of rumen-protected amino acids. The greater abundance of fibrolytic bacteria such as Fibrobacter succinogenes, and starch-degrading bacteria Abbreviations DM: Dry matter; DMI: Dry matter intake; IAA: Indispensable amino acids; such as Succinimonas amylolytica and Succinivibrio dextri- RPM: Rumen-protected methionine; TMR: Total mixed ration; VFA: Volatile nosolvens at −10 d relative to parturition in the SM group fatty acid was not associated with differences in DMI; however, the lower abundance of these species in response to SM at 20 d Acknowledgements We gratefully acknowledge the help from the staff at the Dairy Research could have been related with the greater DMI in those Farm, University of Illinois, Urbana. cows, potentially due to a change in the rumen kinetics such as liquid dilution rate. It is well-established that in- Funding creases in dietary concentrate/grain to forage not only in- Not applicable. crease intake but also liquid dilution rate [33]. Thus, Availability of data and materials besides the greater DMI in cows fed SM, the higher content The datasets during and/or analyzed during the current study available from of corn grain in the postpartum diet (Table 1) might have the corresponding authors on reasonable request. reduced rumen-retention time of digesta which could partly explain the lower abundance of bacteria. Recent studies Authors’ contributions Conceived and designed the experiments: JJL. Performed the analyses: MKA, demonstrated that RPM can increase DMI both pre and AAE, ZZ, JCM. Wrote the manuscript: MKA, AAE, VL, JJL. Agree with manuscript postpartum in dairy cows [16, 34]. It remains to be deter- results and conclusions: MKA, AAE, ZZ, VL, JCM, JJL. All authors reviewed and mined if the greater DMI and lower relative abundance due approved of the final manuscript. to feeding SM would affect digestive enzyme activity within Ethics approval and consent to participate the rumen. Not applicable. The response of Anaerovibrio lipolytica after parturition confirms its role in the hydrolysis of triacylglycerol into Consent for publication free fatty acids in the rumen [35]. The inverse relationship Not applicable. between Anaerovibrio lipolytica and Fibrobacter succino- Competing interests genes as it relates to dietary fiber and lipid level was con- The authors declare that they have no competing interests. firmed previously [36]. A previous study [12] also speculated that Anaerovibrio lipolytica (like Megasphaera Author details Department of Animal Sciences, Mammalian NutriPhysioGenomics, elsdenii) can use lactate as a substrate for growth during University of Illinois, Urbana, IL 61801, USA. Department of Animal Medicine, feeding of higher-fermentable diets after parturition. The Faculty of Veterinary Medicine, Kafrelsheikh University, Kafr El-Shaikh 33516, lack of day, treatment, or interaction effect on the relative Egypt. Department of Animal and Veterinary Sciences, Clemson University, Clemson, SC 29634, USA. Department of Health Science, Interdepartmental abundance of Butyrivibrio proteoclasticus and Eubacterium Services Centre of Veterinary for Human and Animal Health, Magna Græcia ruminantium implies that these bacteria might be less 5 University of Catanzaro, 88100 Catanzaro, Italy. Division of Nutritional sensitive to changes during the transition period. Sciences, Illinois Informatics Institute, University of Illinois, Urbana, IL, USA. Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 7 of 7 Received: 30 June 2017 Accepted: 5 January 2018 23. Fernando SC, Purvis HT 2nd, Najar FZ, Sukharnikov LO, Krehbiel CR, Nagaraja TG, et al. Rumen microbial population dynamics during adaptation to a high-grain diet. Appl Environ Microbiol. 2010;76:7482–90. 24. Stewart CS, Flynt HJ, Bryant MP. The rumen bacteria. In: Stewart PNHaCS, References editor. The rumen microbial ecosystem. New York: Blackie Academic and 1. Jones BA, Mohamed OE, Prange RW, Satter LD. Degradation of methionine Professional; 1997. p. 10–72. hydroxy analog in the rumen of lactating cows. J Dairy Sci. 1988;71:525–9. 25. Wang X, Li X, Zhao C, Hu P, Chen H, Liu Z, et al. Correlation between 2. Clark JH. Lactational responses to Postruminal administration of proteins composition of the bacterial community and concentration of volatile fatty and amino Acids1. J Dairy Sci. 1975;58:1178–97. acids in the rumen during the transition period and ketosis in dairy cows. 3. Gil LA, Shirley RL, Moore JE. Effect of methionine hydroxy analog on Appl Environ Microbiol. 2012;78:2386–92. bacterial protein synthesis from urea and glucose, starch or cellulose by 26. Reynolds CK, Huntington GB, Tyrrell HF, Reynolds PJ. Net metabolism of rumen microbes, in vitro. J Anim Sci. 1973;37:159–63. volatile fatty acids, D-beta-hydroxybutyrate, nonesterifield fatty acids, and 4. Overton TR, LaCount DW, Cicela TM, Clark JH. Evaluation of a ruminally protected blood gasses by portal-drained viscera and liver of lactating Holstein cows. J methionine product for lactating dairy cows. J Dairy Sci. 1996;79:631–8. Dairy Sci. 1988;71:2395–405. 5. Chalupa W. Rumen bypass and protection of proteins and amino acids. J 27. Russell JB, Cotta MA, Dombrowski DB. Rumen bacterial competition in Dairy Sci. 1975;58:1198–218. continuous culture: Streptococcus Bovis versus Megasphaera elsdenii. Appl 6. Lee C, Giallongo F, Hristov AN, Lapierre H, Cassidy TW, Heyler KS, et al. Effect Environ Microbiol. 1981;41:1394–9. of dietary protein level and rumen-protected amino acid supplementation 28. Russell JR, Hino T. Regulation of lactate production in Streptococcus Bovis: a on amino acid utilization for milk protein in lactating dairy cows. J Dairy Sci. spiraling effect that contributes to rumen acidosis. J Dairy Sci. 1985;68:1712–21. 2015;98:1885–902. 29. Khafipour E, Li S, Plaizier JC, Krause DO. Rumen microbiome composition 7. Li C, Batistel F, Osorio JS, Drackley JK, Luchini D, Loor JJ. Peripartal rumen- determined using two nutritional models of subacute ruminal acidosis. Appl protected methionine supplementation to higher energy diets elicits Environ Microbiol. 2009;75:7115–24. positive effects on blood neutrophil gene networks, performance and liver 30. Rodríguez F. Control of lactate accumulation in ruminants using Prevotella lipid content in dairy cows. J Anim Sci Biotechnol. 2016;7:18. bryantii. PhD thesis Iowa State University, Ames. 2003. 8. Osorio JS, Jacometo CB, Zhou Z, Luchini D, Cardoso FC, Loor JJ. Hepatic 31. Yang SL, Bu DP, Wang JQ, Hu ZY, Li D, Wei HY, et al. Soybean oil and global DNA and peroxisome proliferator-activated receptor alpha promoter linseed oil supplementation affect profiles of ruminal microorganisms in methylation are altered in peripartal dairy cows fed rumen-protected dairy cows. Animal. 2009;3:1562–9. methionine. J Dairy Sci. 2016;99:234–44. 32. Chen JWP. Competition among three predominant ruminal cellulolytic 9. Zhou Z, Bulgari O, Vailati-Riboni M, Trevisi E, Ballou MA, Cardoso FC, et al. bacteria in the absence or presence of non-cellulolytic bacteria. Rumen-protected methionine compared with rumen-protected choline Microbiology. 2001;147:21–30. improves immunometabolic status in dairy cows during the peripartal 33. Stokes MR, Bull LS, Halteman WA. Rumen liquid dilution rate in dairy cows period. J Dairy Sci. 2016;99:8956–69. fed once daily: effects of diet and sodium bicarbonate supplementation. J 10. Pitta DW, Kumar S, Vecchiarelli B, Shirley DJ, Bittinger K, Baker LD, et al. Dairy Sci. 1985;68:1171–80. Temporal dynamics in the ruminal microbiome of dairy cows during the 34. Batistel F, Arroyo JM, Bellingeri A, Wang L, Saremi B, Parys C, et al. Ethyl-cellulose transition period. J Anim Sci. 2014;92:4014–22. rumen-protected methionine enhances performance during the periparturient 11. Lima FS, Oikonomou G, Lima SF, Bicalho ML, Ganda EK, Filho JC, et al. period and early lactation in Holstein dairy cows. J Dairy Sci. 2017;100:7455–7467. Prepartum and postpartum rumen fluid microbiomes: characterization and 35. Harfoot CGH, G. P.: Lipid metabolism in the rumen.. In: The Rumen Microbial correlation with production traits in dairy cows. Appl Environ Microbiol. Ecosystem. Edited by P. N. Hobson DSS, vol. 2nd ed. London, UK: Chapman 2015;81:1327–37. and Hall; 1997;382–426. 12. Minuti A, Palladino A, Khan MJ, Alqarni S, Agrawal A, Piccioli-Capelli F, et al. 36. Liu SJ, Bu DP, Wang JQ, Liu L, Liang S, Wei HY, et al. Effect of incremental Abundance of ruminal bacteria, epithelial gene expression, and systemic levels of fish oil supplementation on specific bacterial populations in bovine biomarkers of metabolism and inflammation are altered during the ruminal fluid. J Anim Physiol Anim Nutr (Berl). 2012;96:9–16. peripartal period in dairy cows. J Dairy Sci. 2015;98:8940–51. 37. Stevenson DM, Weimer PJ. Dominance of Prevotella and low abundance of 13. Firkins JL, Yu Z. RUMINANT NUTRITION SYMPOSIUM: How to use data on classical ruminal bacterial species in the bovine rumen revealed by relative the rumen microbiome to improve our understanding of ruminant quantification real-time PCR. Appl Microbiol Biotechnol. 2007;75:165–74. nutrition. J Anim Sci. 2015;93:1450–70. 14. Loor JJ, Elolimy AA, JC MC. Dietary impacts on rumen microbiota in beef and dairy production. Anim Front. 2016;6:22–9. 15. Salsbury RL, Marvil DK, Woodmansee CW, Haenlein GFW. Utilization of Methionine and Methionine Hydroxy analog by rumen microorganisms in vitro. J Dairy Sci. 1971;54:390–6. 16. Zhou Z, Vailati-Riboni M, Trevisi E, Drackley JK, Luchini DN, Loor JJ. Better postpartal performance in dairy cows supplemented with rumen-protected methionine compared with choline during the peripartal period. J Dairy Sci. 2016;99:8716–32. 17. Osorio JS, Ji P, Drackley JK, Luchini D, Loor JJ. Supplemental Smartamine M or MetaSmart during the transition period benefits postpartal cow performance and blood neutrophil function. J Dairy Sci. 2013;96:6248–63. Submit your next manuscript to BioMed Central 18. Yu Z, Morrison M. Improved extraction of PCR-quality community DNA from digesta and fecal samples. BioTechniques. 2004;36:808–12. and we will help you at every step: 19. Maeda H, Fujimoto C, Haruki Y, Maeda T, Kokeguchi S, Petelin M, et al. • We accept pre-submission inquiries Quantitative real-time PCR using TaqMan and SYBR green for Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, � Our selector tool helps you to find the most relevant journal tetQ gene and total bacteria. FEMS Immunol Med Microbiol. 2003;39:81–6. � We provide round the clock customer support 20. Fliegerova K, Tapio I, Bonin A, Mrazek J, Callegari ML, Bani P, et al. Effect of � Convenient online submission DNA extraction and sample preservation method on rumen bacterial population. Anaerobe. 2014;29:80–4. � Thorough peer review 21. Ramirez-Farias C, Slezak K, Fuller Z, Duncan A, Holtrop G, Louis P. Effect of � Inclusion in PubMed and all major indexing services inulin on the human gut microbiota: stimulation of Bifidobacterium � Maximum visibility for your research adolescentis and Faecalibacterium prausnitzii. Br J Nutr. 2009;101:541–50. 22. Caldwell DRBM. Medium without rumen fluid for non- selective enumeration Submit your manuscript at and isolation of rumen bacteria. Appl Environ Microbiol. 1966;14:794–801. www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Animal Science and Biotechnology Springer Journals

Rumen-protected methionine during the peripartal period in dairy cows and its effects on abundance of major species of ruminal bacteria

Download PDF
7 pages

Loading next page...
 
/lp/springer-journals/rumen-protected-methionine-during-the-peripartal-period-in-dairy-cows-IcyhdjwyL3

References (39)

Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s).
Subject
Life Sciences; Agriculture; Biotechnology; Food Science; Animal Genetics and Genomics; Animal Physiology
eISSN
2049-1891
DOI
10.1186/s40104-018-0230-8
Publisher site
See Article on Publisher Site

Abstract

Background: Extensive degradation of amino acids in the rumen via microbial deamination decreases the post- ruminal availability of dietary indispensable amino acids. Together with the normal decrease in voluntary dry matter intake (DMI) around parturition in dairy cows, microbial metabolism contributes to a markedly negative balance of indispensable amino acids, including methionine which may be the first-limiting for milk production. The main objective of the current study was to profile changes in major bacterial species with key functions in cellulose and hemicellulose digestion, xylan breakdown, proteolytic action, propionic acid production, lactate utilization and ruminal biohydrogenation in cows supplemented with rumen-protected Methionine (SM; Smartamine M, Adisseo NA, Alpharetta, GA, USA) from −23 through 30 d relative to parturition. Because ~90% of the methionine in SM bypasses the rumen, ~10% of the methionine is released into the rumen and can be utilized by microbes. Results: As expected, there was an increase in overall DMI after parturition (Day, P < 0.05) during which cows consumed on average 19.6 kg/d versus 13.9 kg/d in the prepartum period. The postpartum diet contained greater concentrations of lipid and highly-fermentable carbohydrate from corn grain, which likely explains the increases in the relative abundance of Anaerovibrio lipolytica, Megasphaera elsdenii, Prevotella bryantii, Selenomonas ruminantium, Streptococcus bovis,and Succinimonas amylolytica. Despite similar DMI prepartum, cows fed SM had greater (Treatment × Day, P < 0.05) abundance prepartum of Fibrobacter succinogenes, Succinimonas amylolytica,and Succinivibrio dextrinosolvens. However, the greater DMI in cows fed SM after parturition (19.6 kg/d versus 13.9 kg/d) was −3 −4 associated with lower abundance of Fibrobacter succinogenes (2.13 × 10 versus 2.25 × 10 )and Selenomonas −1 −1 ruminantium (2.98 × 10 versus 4.10 × 10 ). A lower abundance (Day, P < 0.05) was detected on d 20 compared with d −10 for Fibrobacter succinogenes and Succinivibrio dextrinosolvens. The relative abundance of Butyrivibrio proteoclasticus and Eubacterium ruminantium was stable across treatment and time. (Continued on next page) * Correspondence: jloor@illinois.edu Department of Animal Sciences, Mammalian NutriPhysioGenomics, University of Illinois, Urbana, IL 61801, USA Division of Nutritional Sciences, Illinois Informatics Institute, University of Illinois, Urbana, IL, USA Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 2 of 7 (Continued from previous page) Conclusions: In diets with proper balance of rumen-degradable protein and fermentable carbohydrate, the small fraction of Methionine released from the rumen-protected supplement did not seem to compromise growth of major bacterial species in the rumen. In fact, it had a positive effect on 3 major species prepartum when DMI was similar between groups. Because the actual requirements of Methionine (and Lysine, for example) by the cow during the transition period are unknown, it appears warranted to study the rumen microbiome as it relates to supply of rumen-protected amino acids. Keywords: Microbiome, Rumen microbes, Transition cow Background species with key functions in cellulose and hemicellulose Extensive degradation of amino acids in the rumen [1] via digestion, xylan breakdown, proteolytic action, propionic microbial deamination [2, 3] substantially lowers the post- acid production, lactate utilization and ruminal biohydro- ruminal availability of dietary indispensable amino acids genation in cows supplemented with RPM (Smartamine (IAA). Together with the normal decrease in voluntary dry M, Adisseo NA, Alpharetta, GA) from −23 through 30 d matter intake (DMI) around parturition in dairy cows, around parturition. Smartamine M is designed to release microbial metabolism contributes to a markedly negative over 90% of the methionine along the small intestine. balance of IAA, including methionine which often is the Thus, the remaining 10% of the methionine is released first-limiting amino acid [4]. Therefore, the importance of into the rumen and can be utilized by microbes. Hence, enhancing the delivery methionine to the small intestine the hypothesis was that the liberated methionine portion through “rumen by-pass” technologies has been under- into the rumen following dietary RPM supplementation scored since the early 1960’s [5]. The physiologic impact of could affect the composition of major ruminal bacteria supplementing dairy diets with rumen-protected methio- around calving. nine (RPM) at lactation stages where needs are the greatest has received close attention worldwide, i.e. improving the Methods overall health, metabolism, and production performance Animal handling and all procedures of this study received in dairy cows [6–9]. With the advances in methionine pro- approval from the Institutional Animal Care and Use tection technology, a large proportion of protected me- Committee of the University of Illinois under protocol no. thionine escapes ruminal degradation but a small fraction 13023. In total, a subset of 20 multiparous cows from a of methionine is still released into the rumen and may larger study [16] were randomly selected for ruminal fluid change the community composition of the rumen micro- sampling. These cows were either fed a control diet with- biota and their metabolism. out RPM (CON) or CON plus RPM supplementation During the peripartal period, dairy cow diets move from (SM) at a rate of 0.08% of DMI (Smartamine M, Adisseo higher-forage content before calving to higher-concentrate NA, Alpharetta, GA). Dosage of RPM was based on previ- diets postpartum to provide the rumen microbial communi- ous work from our research group [17]. At the start of the ties with more readily-available energy. As a result, microbial experimental feeding phase, none of the cows enrolled composition changes in favor of generating more volatile had received any type of RPM. All cows received a far-off fatty acids (VFA) and microbial protein to serve as a fuel and diet (Table 1) as total mixed ration (TMR) from −50 to amino acid sources, respectively, for body tissues and milk −22 d before expected calving date (1.40 Mcal/kg of DM, synthesis [10–12]. Therefore, nutritional management plays a 10.2% rumen-degradable protein, and 4.1% rumen- key role in shaping the microbial ecosystem in the rumen undegradable protein), a close-up diet from −21 d to the [13, 14]. Despite the continued focus on nutritional manage- expected calving date (1.52 Mcal/ kg of DM, 9.1% rumen- ment of peripartal cows, little is known about the response degradable protein, and 5.4% rumen-undegradable pro- of rumen microbes to methionine supplementation. For ex- tein) and a lactation diet after calving through 30 d post- ample, Salsbury et al. [15] and Gil et al. [3] were among the partum (1.71 Mcal/kg of DM, 9.7% rumen-degradable first to observe that unprotected supplemental methionine protein, and 7.5% rumen-undegradable protein). The enhanced ruminal bacteria growth rate and protein synthesis TMR was delivered once daily (0600 h) using an electronic in vitro. recognition feeding system for each cow (American Calan, Although there is growing evidence that RPM enhances Northwood, NH) before calving or in open individual overall dairy cow health and productivity, whether ruminal mangers during lactation. The DM content of the TMR bacteria composition changes in response to RPM supple- for the close-up and lactation diets was measured weekly mentation remains unknown. Therefore, the objective of for estimation of daily TMR dry matter offered. The re- the current study was to profile changes in major bacterial quired amount of RPM was calculated daily for each Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 3 of 7 Table 1 Ingredients and chemical composition of experimental Ruminal bacteria DNA isolation and qPCR amplification of diets 16S rDNA genes Diet At −10 d before expected calving date and d 20 postpar- tum, ruminal fluid was sampled from each cow using a Ingredient, Far-off Close-up Lactation %ofDM stomach tube prior to the morning feeding. The sample Alfalfa silage 12.00 8.34 5.07 was filtered through three layers of cheesecloth. Mixed ru- minal fluid was immediately frozen in liquid nitrogen Alfalfa hay – 4.29 2.98 followed by storage at −80 °C. Total genomic DNA was iso- Corn silage 33.00 36.40 33.41 lated using the repeated bead beating method described by Wheat straw 36.00 15.63 2.98 Yu and Morrison [18] for mechanical lysis of bacterial cell Cottonseed –– 3.58 wall, employing the QIAamp DNA mini kit (QIAGEN) for Wet brewers – 4.29 9.09 DNA purification. The DNA quantity and quality were grains checked by 0.8% (wt/v) agarose gel electrophoresis and Ground shelled 4.00 12.86 23.87 NanoDrop spectrophotometer (ND 1000, NanoDrop corn Technologies, Inc., Wilmington, DE, USA) at 260 nm. Ex- Soy hulls 2.00 4.29 4.18 tracted DNA was standardized to 8 ng/μLfor qPCR. Soybean meal, 7.92 2.57 2.39 The primer sets selected to amplify 10 targeted rumen 48% CP bacterial species are listed in Table 2 and were validated Expeller soybean – 2.57 5.97 using gel electrophoresis. A total of 10 μL of qPCR mix- meal ture contained 4 μLsample DNA, 5 μL1× SYBR Green Soychlor 0.15 3.86 – with ROX (Quanta BioSciences, Gaithersburg, MD, USA), Blood meal, 85% 1.00 –– 0.4 μLeach of 10 μmol/L forward and reverse primers, CP and 0.2 μL DNase/RNase free water in a MicroAmp™ Op- ProVAAl AADvantage – 0.86 1.50 tical 384-Well Reaction Plate (Applied Biosystems, Foster Urea 0.45 0.30 0.18 City, CA, USA). Negative controls without template DNA, Rumen-inert fat –– 1.02 standards, and samples were run on the same plate in trip- licate. The qPCR reactions were performed with the ABI Limestone 1.30 1.29 1.31 Prism 7900HT Fast Real-Time PCR System (Applied Bio- Salt 0.32 0.30 0.30 systems, Foster City, CA, USA) using the following pro- Dicalcium phosphate 0.12 0.18 0.30 gram: initial denaturation at 95 °C for 5 min, followed by Magnesium oxide 0.21 0.08 0.12 40 cycles of 1 s at 95 °C and 30 s annealing at 60 °C, ex- Magnesium sulfate 0.91 0.99 – cept for eubacterial primer 3 that required an annealing Sodium bicarbonate –– 0.79 temperature of 56 °C. A dissociation stage was performed to determine the specificity of the amplification. Relative Potassium carbonate –– 0.30 abundance of bacterial species was calculated using the Calcium sulfate –– 0.12 geometric mean of two universal primers [19, 20] with the Mineral vitamin mix 0.20 0.17 0.18 −CT efficiency-corrected Δ method [21]. Thus, the abun- Vitamin A 0.015 –– dance of each target bacteria was determined relative to Vitamin D 0.025 –– the overall abundance of the total bacteria as measured Vitamin E 0.38 0.39 – with the universal primers. Biotin – 0.35 0.35 a Statistical analysis SoyPLUS (West Central Soy, Ralston, IA) By West Central Soy Drymatterintakeand relative abundanceof bacteriawere Perdue AgSolutions LLC (Ansonia, OH) analyzed using the MIXED procedure of SAS 9.3 (SAS Inst. Energy Booster 100 (Milk Specialties Global, Eden Prairie, MN) Inc., Cary, NC, USA). The fixed effects in the model were Contained a minimum of 5% Mg, 10% S, 7.5% K, 2.0% Fe, 3.0% Zn, 3.0% Mn, 5,000 mg of Cu/kg, 250 mg of I/kg, 40 mg of Co/kg, Day, Treatment, and the interaction of Day × Treatment. 150 mg of Se/kg, 2,200 kIU of vitamin A/kg, 660 kIU of vitamin The random effect was cow within treatment. D /kg, and 7,700 IU of vitamin E/kg Contained 30,000 kIU/kg Contained 5,009 kIU/kg Results Contained 44,000 kIU/kg Dry matter intake individual cow and was top-dressed from −21 ± 2 to As expected, there was an increase in overall DMI after 30 d relative to parturition once daily at the morning parturition (Day, P < 0.05) during which cows consumed feeding using approximately 50 g of ground corn as on average 19.6 kg/d versus 13.9 kg/d in the prepartum carrier. period. The overall effect of treatment (P < 0.05) was due Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 4 of 7 Table 2 Species-specific primers for the quantification of selected rumen bacterial populations using a real-time qPCR assay Target bacterial Primer sequence Reference species (5' → 3') Anaerovibrio lipolytica F: GAAATGGATTCTAGTGGCAAACG [12] R: ACATCGGTCATGCGACCAA Butyrivibrio proteoclasticus F: GGGCTTGCTTTGGAAACTGTT [12] R: CCCACCGATGTTCCTCCTAA Eubacterium ruminantium F: CTCCCGAGACTGAGGAAGCTTG [37] R: GTCCATCTCACACCACCGGA Fibrobacter succinogenes F: GCGGGTAGCAAACAGGATTAGA [37] R: CCCCCGGACACCCAGTAT Megaspheara elsdenii F: AGATGGGGACAACAGCTGGA [37] R: CGAAAGCTCCGAAGAGCCT Prevotella bryantii F: AGCGCAGGCCGTTTGG [37] R: GCTTCCTGTGCACTCAAGTCTGAC Selenomonas ruminantium F: CAATAAGCATTCCGCCTGGG [37] R: TTCACTCAATGTCAAGCCCTGG Succinimonas amylolytica F: CGTTGGGCGGTCATTTGAAAC [29] R: CCTGAGCGTCAGTTACTATCCAGA Streptococcus bovis F: TTCCTAGAGATAGGAAGTTTCTTCGG [37] R: ATGATGGCAACTAACAATAGGGGT Succinivibrio dextrinosolvens F: TAGGAGCTTGTGCGATAGTATGG [29] R: CTCACTATGTCAAGGTCAGGTAAGG Bacteria general 1 F: GGATTAGATACCCTGGTAGT [20] R: CACGACACGAGCTGACG Bacteria general 2 F: GTGSTGCAYGGYTGTCGTCA [19] R: ACGTCRTCCMCACCTTCCTC a b F forward primer; R reverse primer to cows in the SM group consuming ~3 kg DM more than those in the CON group specifically after partur- ition (Fig. 1; 19.6 kg/d versus 13.9 kg/d). CON SM a Abundance of ruminal bacteria The relative abundance of target bacterial species is pre- 20 b sented in Table 3. Selenomonas ruminantium was the only bacterial species with an overall treatment effect (P = 0.01) due to a 27.4% decrease in abundance with SM supplementation. Furthermore, this was the most- −1 abundant bacterial species ranging from 2.63×10 at −1 5 −10 d (SM) to 6.39×10 (a peak in abundance) at 20 d in cows fed CON. Concerning day effects, greater relative abundance of -10 20 Fibrobacter succinogenes (P < 0.01) and Succinivibrio dex- Day relative to parturition trinosolvens (P = 0.05) was observed at −10 d compared Fig. 1 Dry matter intake in Holstein cows fed a control diet (CON) or with 20 d postpartum. Furthermore, there was a day effect CON supplemented with rumen-protected methionine (SM) from d ab (P < 0.01) for Anaerovibrio lipolytica, Megasphaera elsde- −21 through d 30 relative to parturition. Different letters denote treatment effects (P < 0.05) between treatments. The P value for the nii, Prevotella bryantii, Selenomonas ruminantium and overall effect of Treatment, Day, and Treatment × Day was 0.002, 0.03, Streptococcus bovis (P = 0.02) as these bacterial species and 0.48, respectively. Bars indicate standard error of the means had greater abundance at 20 d compared with −10 d Dry matter intake, kg/d Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 5 of 7 Table 3 Relative abundance of microbial species in mixed ruminal fluid from Holstein cows fed a control diet (CON) or CON supplemented with rumen-protected methionine (SM) during the periparturient period Day × Treatment Treatment Day CON SM P value Species CON SM −10 20 −10 20 −10 20 Trt Day T × D −3 −3 -3b -3a −3 −3 −3 −3 A. lipolytica 3.28×10 3.42×10 2.50×10 4.48×10 2.25×10 4.77×10 2.77×10 4.21×10 0.82 <0.01 0.42 −2 −3 −2 −3 −2 −3 −3 −3 B. proteoclasticus 1.07×10 8.88×10 1.01×10 9.46×10 1.24×10 9.29×10 8.18×10 9.64×10 0.20 0.67 0.13 −2 −2 −2 −2 −2 −2 −2 −2 E. ruminantium 2.44×10 2.45×10 2.23×10 2.69×10 2.59×10 2.31×10 1.92×10 3.13×10 0.98 0.38 0.16 −4 −4 -3a -4b -4B -4B -3A -4C F. succinogenes 7.10×10 6.93×10 1.16×10 4.25×10 6.29×10 8.02×10 2.13×10 2.25×10 0.92 <0.01 <0.01 −5 −5 -6b -4a −6 −4 −6 −4 M. elsdenii 3.90×10 1.90×10 2.40×10 2.34×10 4.60×10 2.07×10 1.00×10 2.65×10 0.43 <0.01 0.24 −3 −3 -4b -3a −3 −2 −4 −3 P. bryantii 4.22×10 1.30×10 7.61×10 7.20×10 1.12×10 1.60×10 5.19×10 3.25×10 0.12 <0.01 0.57 -1a -1b -1b -1a -1C -1A -1C -1BC S. ruminantium 4.10×10 2.98×10 2.63×10 4.65×10 2.63×10 6.39×10 2.63×10 3.37×10 0.01 <0.01 0.01 −4 −4 −4 −5 -5B -4B -4A -5B S. amylolytica 1.02×10 2.30×10 2.51×10 9.40×10 9.90×10 1.05×10 6.32×10 8.40×10 0.16 0.07 0.05 −5 −4 -4a -5b -5B -4B -4A -5B S. dextrinosolvens 9.10×10 1.60×10 1.71×10 8.50×10 8.10×10 1.02×10 3.64×10 7.00×10 0.10 0.05 0.01 −3 −3 -3b -3a −3 −3 −3 −3 S. bovis 8.09×10 3.50×10 3.17×10 8.93×10 6.68×10 9.79×10 1.51×10 8.14×10 0.22 0.02 0.14 Trt treatment effect, Day day effect, T×D Treatment by Day interaction ab Means for overall Treatment or Day effect differ (P < 0.05) A-C Means for the interaction of Day × Treatment differ (P < 0.05) around parturition. Succinimonas amylolytica tended to this species or increased the diversity of the rumen be greater (P =0.07) at −10 compared with 20 d. population. The relative abundance of Butyrivibrio proteoclasticus Availability of propionate for gluconeogenesis by the and Eubacterium ruminantium was stable (P > 0.05) across animal during the transition into lactation relies heavily treatment and time. However, Eubacterium ruminantium on both Selenomonas ruminantium and Megasphaera was the second most-abundant bacterial species among elsdenii numbers in the rumen [25]. Approximately 90% −2 those studied, ranging from 1.92×10 at −10 d with SM of glucose in ruminants is supplied by gluconeogenesis, −2 to 3.13×10 at 20 d also with SM. with 50 to 60% of this being derived from propionate A Day × Treatment interaction was observed for Fibro- [26]. Thus, the longitudinal change in Selenomonas bacter succinogenes, Selenomonas ruminantium, Succinivi- ruminantium and Megasphaera elsdenii agrees with brio dextrinosolvens, and S. amylolytica. Selenomonas higher content of rapidly-fermentable carbohydrate in ruminantium abundance nearly doubled (P = 0.01) between the postpartum diet, i.e. substrate availability likely −10 and 20 d only in CON cows. In contrast, Fibrobacter helped enhance the numbers of these species [23]. succinogenes, Succinimonas amylolytica and Succinivibrio Except for Butyrivibrio proteoclasticus (fibrolytic spe- dextrinosolvens decreased on d 20 in SM cows while no cies), the greater numbers of Anaerovibrio lipolytica, change or a decrease was observed in CON cows. Prevotella bryantii, Megasphaera elsdenii, Selenomonas ruminantium, and Streptococcus bovis at d 20 postpar- Discussion tum along with the lower numbers of Fibrobacter succi- Selenomonas ruminantium was the most abundant bac- nogenes, Succinimonas amylolytica, and Succinivibrio terial species observed in the present study and agrees dextrinosolvens were consistent with a previous study with previous classical studies indicating that this Gram- [12]. They attributed these changes to the important fea- negative bacteria could account for up to 51% of the tures associated with the transition into lactation, e.g. total viable bacterial counts within the rumen [22]. The greater concentration of lipid and rapidly-fermentable fact that Selenomonas ruminantium was overall 27.4% carbohydrate as a way to provide more energy for the lower in response to RPM supplementation could have cow during a period when voluntary DMI may be less been associated with the greater DMI in those cows after than optimal. parturition. This microbial species is a propionate- Thefactthatabundance of Streptococcus bovis and Pre- producer through decarboxylation of succinate, which votella bryantii at 20 d postpartum was associated with involves lactic acid production particularly during feed- greater abundance of Selenomonas ruminantium and ing of higher-concentrate diets [23, 24]. Thus, because Megasphaera elsdenii seems to indicate some degree of the numbers of Selenomonas ruminantium in SM-fed synchronization. These results are broadly consistent with cows actually increased numerically after parturition other studies demonstrating that, as dietary grain in- relative to the prepartum period, it is likely that the creases, the prevalence of starch-fermenting bacteria like greater DMI in those cows either diluted the numbers of Streptococcus bovis is increased with a consequent Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 6 of 7 synchronized increase in the population ratio of lactate- Clearly, the diets used in the present study appear to consuming bacteria like Selenomonas ruminantium and have provided enough fermentable energy and nitrogen Megasphaera elsdenii to help eliminate lactate via fermen- sources to allow normal growth of the major microbes tation to propionate [25, 27–29]. Prevotella spp. grows studied. Whether the rumen microbiome responds to rapidly on starch and produce succinate and propionate the supply of rumen-protected supplements needs to be as major end-products [29, 30]. A previous study [12] at- explored further. This is particularly important because tributed a higher proportion of Megasphaera elsdenii and the actual requirements of methionine (and lysine, for Prevotella bryantii after parturition to the higher DMI, example) during the transition period are unknown. which agrees with data in the present study. The lower abundance of Fibrobacter succinogenes post- Conclusions partum was associated with greater abundance of Anae- In diets with proper balance of rumen-degradable pro- rovibrio lipolytica and seems to be partly explained by a tein and fermentable carbohydrate, the small fraction of potential negative effect of higher availability of dietary Methionine released from the rumen-protected supple- unsaturated fatty acids on ruminal cellulolytic bacteria ment did not seem to compromise growth of major bac- [31]. Indirectly, these results suggest that the greater terial species in the rumen. In fact, it had a positive fiber content of the prepartum diet allowed for greater effect on 3 major species prepartum when DMI was numbers of Fibrobacter succinogenes, which agrees with similar between groups. Because the actual requirements a previous study [25]. In ruminants fed high-forage diets of Methionine (and Lysine, for example) by the cow dur- Fibrobacter succinogenes is one of the predominant cel- ing the transition period are unknown, it appears war- lulolytic species, favoring the greater production of acet- ranted to study the rumen microbiome as it relates to ate relative to propionate [32]. supply of rumen-protected amino acids. The greater abundance of fibrolytic bacteria such as Fibrobacter succinogenes, and starch-degrading bacteria Abbreviations DM: Dry matter; DMI: Dry matter intake; IAA: Indispensable amino acids; such as Succinimonas amylolytica and Succinivibrio dextri- RPM: Rumen-protected methionine; TMR: Total mixed ration; VFA: Volatile nosolvens at −10 d relative to parturition in the SM group fatty acid was not associated with differences in DMI; however, the lower abundance of these species in response to SM at 20 d Acknowledgements We gratefully acknowledge the help from the staff at the Dairy Research could have been related with the greater DMI in those Farm, University of Illinois, Urbana. cows, potentially due to a change in the rumen kinetics such as liquid dilution rate. It is well-established that in- Funding creases in dietary concentrate/grain to forage not only in- Not applicable. crease intake but also liquid dilution rate [33]. Thus, Availability of data and materials besides the greater DMI in cows fed SM, the higher content The datasets during and/or analyzed during the current study available from of corn grain in the postpartum diet (Table 1) might have the corresponding authors on reasonable request. reduced rumen-retention time of digesta which could partly explain the lower abundance of bacteria. Recent studies Authors’ contributions Conceived and designed the experiments: JJL. Performed the analyses: MKA, demonstrated that RPM can increase DMI both pre and AAE, ZZ, JCM. Wrote the manuscript: MKA, AAE, VL, JJL. Agree with manuscript postpartum in dairy cows [16, 34]. It remains to be deter- results and conclusions: MKA, AAE, ZZ, VL, JCM, JJL. All authors reviewed and mined if the greater DMI and lower relative abundance due approved of the final manuscript. to feeding SM would affect digestive enzyme activity within Ethics approval and consent to participate the rumen. Not applicable. The response of Anaerovibrio lipolytica after parturition confirms its role in the hydrolysis of triacylglycerol into Consent for publication free fatty acids in the rumen [35]. The inverse relationship Not applicable. between Anaerovibrio lipolytica and Fibrobacter succino- Competing interests genes as it relates to dietary fiber and lipid level was con- The authors declare that they have no competing interests. firmed previously [36]. A previous study [12] also speculated that Anaerovibrio lipolytica (like Megasphaera Author details Department of Animal Sciences, Mammalian NutriPhysioGenomics, elsdenii) can use lactate as a substrate for growth during University of Illinois, Urbana, IL 61801, USA. Department of Animal Medicine, feeding of higher-fermentable diets after parturition. The Faculty of Veterinary Medicine, Kafrelsheikh University, Kafr El-Shaikh 33516, lack of day, treatment, or interaction effect on the relative Egypt. Department of Animal and Veterinary Sciences, Clemson University, Clemson, SC 29634, USA. Department of Health Science, Interdepartmental abundance of Butyrivibrio proteoclasticus and Eubacterium Services Centre of Veterinary for Human and Animal Health, Magna Græcia ruminantium implies that these bacteria might be less 5 University of Catanzaro, 88100 Catanzaro, Italy. Division of Nutritional sensitive to changes during the transition period. Sciences, Illinois Informatics Institute, University of Illinois, Urbana, IL, USA. Abdelmegeid et al. Journal of Animal Science and Biotechnology (2018) 9:17 Page 7 of 7 Received: 30 June 2017 Accepted: 5 January 2018 23. Fernando SC, Purvis HT 2nd, Najar FZ, Sukharnikov LO, Krehbiel CR, Nagaraja TG, et al. Rumen microbial population dynamics during adaptation to a high-grain diet. Appl Environ Microbiol. 2010;76:7482–90. 24. Stewart CS, Flynt HJ, Bryant MP. The rumen bacteria. In: Stewart PNHaCS, References editor. The rumen microbial ecosystem. New York: Blackie Academic and 1. Jones BA, Mohamed OE, Prange RW, Satter LD. Degradation of methionine Professional; 1997. p. 10–72. hydroxy analog in the rumen of lactating cows. J Dairy Sci. 1988;71:525–9. 25. Wang X, Li X, Zhao C, Hu P, Chen H, Liu Z, et al. Correlation between 2. Clark JH. Lactational responses to Postruminal administration of proteins composition of the bacterial community and concentration of volatile fatty and amino Acids1. J Dairy Sci. 1975;58:1178–97. acids in the rumen during the transition period and ketosis in dairy cows. 3. Gil LA, Shirley RL, Moore JE. Effect of methionine hydroxy analog on Appl Environ Microbiol. 2012;78:2386–92. bacterial protein synthesis from urea and glucose, starch or cellulose by 26. Reynolds CK, Huntington GB, Tyrrell HF, Reynolds PJ. Net metabolism of rumen microbes, in vitro. J Anim Sci. 1973;37:159–63. volatile fatty acids, D-beta-hydroxybutyrate, nonesterifield fatty acids, and 4. Overton TR, LaCount DW, Cicela TM, Clark JH. Evaluation of a ruminally protected blood gasses by portal-drained viscera and liver of lactating Holstein cows. J methionine product for lactating dairy cows. J Dairy Sci. 1996;79:631–8. Dairy Sci. 1988;71:2395–405. 5. Chalupa W. Rumen bypass and protection of proteins and amino acids. J 27. Russell JB, Cotta MA, Dombrowski DB. Rumen bacterial competition in Dairy Sci. 1975;58:1198–218. continuous culture: Streptococcus Bovis versus Megasphaera elsdenii. Appl 6. Lee C, Giallongo F, Hristov AN, Lapierre H, Cassidy TW, Heyler KS, et al. Effect Environ Microbiol. 1981;41:1394–9. of dietary protein level and rumen-protected amino acid supplementation 28. Russell JR, Hino T. Regulation of lactate production in Streptococcus Bovis: a on amino acid utilization for milk protein in lactating dairy cows. J Dairy Sci. spiraling effect that contributes to rumen acidosis. J Dairy Sci. 1985;68:1712–21. 2015;98:1885–902. 29. Khafipour E, Li S, Plaizier JC, Krause DO. Rumen microbiome composition 7. Li C, Batistel F, Osorio JS, Drackley JK, Luchini D, Loor JJ. Peripartal rumen- determined using two nutritional models of subacute ruminal acidosis. Appl protected methionine supplementation to higher energy diets elicits Environ Microbiol. 2009;75:7115–24. positive effects on blood neutrophil gene networks, performance and liver 30. Rodríguez F. Control of lactate accumulation in ruminants using Prevotella lipid content in dairy cows. J Anim Sci Biotechnol. 2016;7:18. bryantii. PhD thesis Iowa State University, Ames. 2003. 8. Osorio JS, Jacometo CB, Zhou Z, Luchini D, Cardoso FC, Loor JJ. Hepatic 31. Yang SL, Bu DP, Wang JQ, Hu ZY, Li D, Wei HY, et al. Soybean oil and global DNA and peroxisome proliferator-activated receptor alpha promoter linseed oil supplementation affect profiles of ruminal microorganisms in methylation are altered in peripartal dairy cows fed rumen-protected dairy cows. Animal. 2009;3:1562–9. methionine. J Dairy Sci. 2016;99:234–44. 32. Chen JWP. Competition among three predominant ruminal cellulolytic 9. Zhou Z, Bulgari O, Vailati-Riboni M, Trevisi E, Ballou MA, Cardoso FC, et al. bacteria in the absence or presence of non-cellulolytic bacteria. Rumen-protected methionine compared with rumen-protected choline Microbiology. 2001;147:21–30. improves immunometabolic status in dairy cows during the peripartal 33. Stokes MR, Bull LS, Halteman WA. Rumen liquid dilution rate in dairy cows period. J Dairy Sci. 2016;99:8956–69. fed once daily: effects of diet and sodium bicarbonate supplementation. J 10. Pitta DW, Kumar S, Vecchiarelli B, Shirley DJ, Bittinger K, Baker LD, et al. Dairy Sci. 1985;68:1171–80. Temporal dynamics in the ruminal microbiome of dairy cows during the 34. Batistel F, Arroyo JM, Bellingeri A, Wang L, Saremi B, Parys C, et al. Ethyl-cellulose transition period. J Anim Sci. 2014;92:4014–22. rumen-protected methionine enhances performance during the periparturient 11. Lima FS, Oikonomou G, Lima SF, Bicalho ML, Ganda EK, Filho JC, et al. period and early lactation in Holstein dairy cows. J Dairy Sci. 2017;100:7455–7467. Prepartum and postpartum rumen fluid microbiomes: characterization and 35. Harfoot CGH, G. P.: Lipid metabolism in the rumen.. In: The Rumen Microbial correlation with production traits in dairy cows. Appl Environ Microbiol. Ecosystem. Edited by P. N. Hobson DSS, vol. 2nd ed. London, UK: Chapman 2015;81:1327–37. and Hall; 1997;382–426. 12. Minuti A, Palladino A, Khan MJ, Alqarni S, Agrawal A, Piccioli-Capelli F, et al. 36. Liu SJ, Bu DP, Wang JQ, Liu L, Liang S, Wei HY, et al. Effect of incremental Abundance of ruminal bacteria, epithelial gene expression, and systemic levels of fish oil supplementation on specific bacterial populations in bovine biomarkers of metabolism and inflammation are altered during the ruminal fluid. J Anim Physiol Anim Nutr (Berl). 2012;96:9–16. peripartal period in dairy cows. J Dairy Sci. 2015;98:8940–51. 37. Stevenson DM, Weimer PJ. Dominance of Prevotella and low abundance of 13. Firkins JL, Yu Z. RUMINANT NUTRITION SYMPOSIUM: How to use data on classical ruminal bacterial species in the bovine rumen revealed by relative the rumen microbiome to improve our understanding of ruminant quantification real-time PCR. Appl Microbiol Biotechnol. 2007;75:165–74. nutrition. J Anim Sci. 2015;93:1450–70. 14. Loor JJ, Elolimy AA, JC MC. Dietary impacts on rumen microbiota in beef and dairy production. Anim Front. 2016;6:22–9. 15. Salsbury RL, Marvil DK, Woodmansee CW, Haenlein GFW. Utilization of Methionine and Methionine Hydroxy analog by rumen microorganisms in vitro. J Dairy Sci. 1971;54:390–6. 16. Zhou Z, Vailati-Riboni M, Trevisi E, Drackley JK, Luchini DN, Loor JJ. Better postpartal performance in dairy cows supplemented with rumen-protected methionine compared with choline during the peripartal period. J Dairy Sci. 2016;99:8716–32. 17. Osorio JS, Ji P, Drackley JK, Luchini D, Loor JJ. Supplemental Smartamine M or MetaSmart during the transition period benefits postpartal cow performance and blood neutrophil function. J Dairy Sci. 2013;96:6248–63. Submit your next manuscript to BioMed Central 18. Yu Z, Morrison M. Improved extraction of PCR-quality community DNA from digesta and fecal samples. BioTechniques. 2004;36:808–12. and we will help you at every step: 19. Maeda H, Fujimoto C, Haruki Y, Maeda T, Kokeguchi S, Petelin M, et al. • We accept pre-submission inquiries Quantitative real-time PCR using TaqMan and SYBR green for Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, � Our selector tool helps you to find the most relevant journal tetQ gene and total bacteria. FEMS Immunol Med Microbiol. 2003;39:81–6. � We provide round the clock customer support 20. Fliegerova K, Tapio I, Bonin A, Mrazek J, Callegari ML, Bani P, et al. Effect of � Convenient online submission DNA extraction and sample preservation method on rumen bacterial population. Anaerobe. 2014;29:80–4. � Thorough peer review 21. Ramirez-Farias C, Slezak K, Fuller Z, Duncan A, Holtrop G, Louis P. Effect of � Inclusion in PubMed and all major indexing services inulin on the human gut microbiota: stimulation of Bifidobacterium � Maximum visibility for your research adolescentis and Faecalibacterium prausnitzii. Br J Nutr. 2009;101:541–50. 22. Caldwell DRBM. Medium without rumen fluid for non- selective enumeration Submit your manuscript at and isolation of rumen bacteria. Appl Environ Microbiol. 1966;14:794–801. www.biomedcentral.com/submit

Journal

Journal of Animal Science and Biotechnology – Springer Journals

Published: Feb 7, 2018

There are no references for this article.