Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer-journals/type-i-fimbriae-mediate-in-vitro-adherence-of-porcine-f18ac-mRrlAMewIw
- Publisher
- Springer Journals
- Copyright
- Copyright © 2017 by Springer-Verlag GmbH Germany and the University of Milan
- Subject
- Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Mycology; Medical Microbiology; Applied Microbiology
- ISSN
- 1590-4261
- eISSN
- 1869-2044
- DOI
- 10.1007/s13213-017-1305-z
- Publisher site
- See Article on Publisher Site
Abstract
Ann Microbiol (2017) 67:793–799 https://doi.org/10.1007/s13213-017-1305-z ORIGINAL ARTICLE Type I fimbriae mediate in vitro adherence of porcine F18ac+ enterotoxigenic Escherichia coli (ETEC) 1 2 3 3 Qiangde Duan & Rahul Nandre & Mingxu Zhou & Guoqiang Zhu Received: 3 April 2017 /Accepted: 10 October 2017 /Published online: 24 October 2017 Springer-Verlag GmbH Germany and the University of Milan 2017 . . . Abstract Type I fimbriae commonly expressed by Keywords F18ac+ ETEC Type I fimbriae Adherence Escherichia coli mediate initial attachment of bacteria to host Biofilm formation epithelial cells. However, the role of type I fimbriae in the adherence of porcine enterotoxigenic E. coli (ETEC) to host receptors is unclear. In this study, we examined the role of type Introduction I fimbriae in the adherence and biofilm formation of F18ac+ ETEC by constructing mutant strains with deletion of type I Post-weaning diarrhea (PWD) causes severe economic losses fimbrial major subunit (fimA)orminorsubunit(fimH). The data to swine production due to high morbidity and mortality indicated that the isogenic ΔfimA and ΔfimH mutants showed (Fairbrother et al. 2005;Rausch etal. 2017). Enterotoxigenic significantly lower adherence to porcine epithelial IPEC-1 and Escherichia coli (ETEC) strains expressing F18ac fimbriae IPEC-J2 cells as compared to the F18ac+ ETEC parent strain. (F18ac+ ETEC) or K88 fimbriae (K88+ ETEC) are the most In addition, the adherence of F18ac+ ETEC to both cell lines common bacterial pathogens causing PWD (de la Fé was blocked by the presence of 0.5% D-mannose in the cell Rodríguez et al. 2011; Frydendahl 2002; Zhang et al. 2007). culture medium. In addition, both mutant strains impaired their Adhesins and enterotoxins [heat-labile enterotoxin (LT) and ability to form biofilm in vitro. Interestingly, the deletion of heat-stable enterotoxin (ST)] of ETEC are known as virulence fimA or fimH genes resulted in remarkable up-regulation of determinants in PWD (Fairbrother et al. 2005; Zhang et al. the expression of adhesin involved in diffuse adherence 2007). Adhesins expressed by F18ac+ ETEC initially mediate (AIDA-I). These results indicated that type I fimbriae may be adherence to pig small intestinal epithelial cells. Adhered bac- required for efficient adherence of F18ac+ ETEC to pig epithe- teria then produce and release enterotoxins into the gut lumen, lial cells and, perhaps, biofilm formation. leading to fluid homeostasis and PWD. Thus, it is believed that initial adherence mediated by classes of adhesins is criti- cal for F18ac+ ETEC infection. Adhesins involved in the Electronic supplementary material The online version of this article F18ac+ ETEC adherence process include F18ac fimbriae (https://doi.org/10.1007/s13213-017-1305-z) contains supplementary and flagella (Frydendahl 2002;Duan et al. 2013). F18ac fim- material, which is available to authorized users. briae mediate F18ac+ ETEC adherence to specific host cell receptors by their adhesive subunit (fedF). Flagella are sug- * Qiangde Duan 254666842@qq.com; dqd8358@163.com gested to contribute to F18ac+ ETEC adherence in two ways: (i) promoting bacteria attachment to host tissue by their mo- * Guoqiang Zhu yzgqzhu@yzu.edu.cn tility property; (ii) directly increasing the adherence mecha- nism as adhesins. Adhesins involved in diffuse adherence Weinan Vocational and Technical College, Weinan 714000, China (AIDA-I) are expressed by F18ac+ ETEC. Additionally, these contribute to colonization and biofilm formation for porcine College of Veterinary Medicine, Kansas State University, Manhattan, KS 66506, USA diarrheagenic E. coli strain PD20 (Ravi et al. 2007). Type I fimbriae are the most commonly expressed pili on College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China the surface of E. coli. They are encoded by the fim gene cluster 794 Ann Microbiol (2017) 67:793–799 that includes nine genes (fimA–fimH) and are required for containing 100 μg/mL of ampicillin (Amp) or 34 μg/ml of fimbrial biosynthesis (Orndorff and Falkow 1984; Klemm chloramphenicol (Cm). For determining bacterial growth and Christiansen 1987). The major structural fimbrial subunit rates, wild-type and mutants strains were grown in LB broth, is encoded by the fimA gene, whereas the minor and adhesive and complemented strains in LB broth containing 100 μg/mL subunit, which is located at the tip of the fimbriae, is encoded of Amp, for 6 h at 37 °C in a shaking incubator at 220 rpm. by the fimH gene (Klemm 1984;Krogfelt etal. 1990). Type I Afterwards, the optical density was measured hourly for each fimbriae mediate bacterial adherence by binding its fimA cultured strain at 600 nm (OD ). adhesin subunit to mannose-containing glycoprotein receptors Newborn porcine small intestinal epithelial cell lines IPEC- on host cells. It is also known that type I fimbriae are impor- J2 and IPEC-1 were cultured in Dulbecco’s minimal Eagle tant adhesins for many pathogens. In uropathogenic E. coli medium (DMEM) (Gibco) supplemented with heat- (UPEC) causing urinary tract infections (UTIs), type I fimbri- inactivated fetal bovine serum (FBS; Gibco) in 5% CO at ae are implicated as virulence factors for UPEC bacterial ini- 37 °C. tial adherence and subsequent invasion to urinary epithelial cells and biofilm formation (Anderson et al. 2003; Wiles Mutant strains and complementary strains construction et al. 2008;Bien et al. 2012). Type I fimbriae mediate adhe- sion and invasion to human brain microvascular endothelial The F18ac+ ETEC fimA (GenBank: CP019558.1) and fimH cells (HBMEC) to develop neonatal meningitis (Murphy et al. (GenBank: JF289169.1) isogenic gene mutants were con- 2013). Additionally, type I fimbriae of E. coli strain LF82 structed using the phage λ-red-mediated recombination sys- mediate adherence to host cells in Crohn’s disease (Boudeau tem as previously described (Datsenko and Wanner 2000). et al. 2001). Also, the type I fimbriae are commonly expressed Briefly, the Cm resistance-encoding gene sequence was am- in F18ac+ ETEC strains. However, their role(s) in adherence plified from the chloramphenicol cassette of plasmid pKD3 in to pig epithelial cells remains poorly understood. polymerase chain reaction (PCR) amplification with ΔfimA-F In this study, we constructed mutants with deletion of and ΔfimA-R primers (Table 2). Amplified PCR products the major subunit (F18acΔfimA) or the minor subunit were purified from agarose gels and transferred into (F18acΔfimH) and examined the ability of the mutant strains F18ac+ ETEC-competent cells containing pKD46 plas- to adhere to piglet epithelial IPEC-1 and IPEC-J2 cell lines. In mid. Positive colonies were selected on LB agar plates addition, we explored the cross-regulation of type I fimbriae containing Amp (100 μg/mL) and Cm (34 μg/mL). and other adhesins of F18ac+ ETEC. Allelic replacement of fimA by the Cm cassette was verified by PCR screening using fimA-specific primers (pBR-fimA-F, pBR-fimA-R; Table 2). Finally, Flp Materials and methods recombinase-expressing vector pCP20 was introduced to delete the Cm cassette. Similarly, the ΔfimH mutant Bacterial strains, plasmids, and cell lines was generated using ΔfimH-F and ΔfimH-R primers (Table 2). Deletion of fimA or fimH in the mutant strains was Bacterial strains and plasmids used in this study are listed in confirmed by PCR screening, DNA sequencing, and hemag- Table 1. Antibiotic-resistant strains were cultured in LB glutination assays. Table 1 Bacterial strains and Strains/plasmids Characteristics Reference source plasmids used in this study 2134P Wild-type, O157:H19:F18ac, 4P−, STa+, STb+ Casey et al. (1992) F18acΔfimA fimA deletion mutant of 2134P In this study F18acΔfimH fimH deletion mutant of 2134P In this study F18acΔfimA/pfimA F18acΔfimA carrying pBR-fimA In this study F18acΔfimH/pfimH F18acΔfimA carrying pBR-fimH In this study Plasmids pKD3 Cm ; Cm cassette template Datsenko and Wanner (2000) pKD46 Amp , λ-red recombinase expression Datsenko and Wanner (2000) r r pCP20 Amp,Cm ; Flp recombinase expression Datsenko and Wanner (2000) pBR322 Expression vector, Amp Takara pBR-fimA pBR322 carrying intact ORF of fimA In this study pBR-fimH pBR322 carrying intact ORF of fimH In this study Ann Microbiol (2017) 67:793–799 795 Table 2 Oligonucleotides used in this study Adherence assays and adherence inhibition assays ΔfimA-F TGGGACCGTTCACTTTAAAGGGGAAGTTGTTA Bacterial adherence assays were performed as previously ACGC CGCTTGCGCAGTTTGTGTAGGCTGGAGCTGCT described (Jouve et al. 1997). Briefly, in each well of a TCG 48-well tissue culture plate (Corning), 1 × 10 IPEC-1or ΔfimA-R GGTTGCAAAATAACGCGCCTGGAACGGAATGG IPEC-J2 cells were challenged with E. coli at 2 × 10 TGTT colony-forming units (CFUs) for 1 h at 37 °C. Cells GGTTCCGTTATTCATATG AATATCCTCCTTAG were washed three times with PBS to remove non-adherent ΔfimH-F ACGTGCGTAATTTGCCGTTAATCCCAGACTTA bacteria, then lysed with 0.5% Triton X-100. Cell lysates were CCGCC GAAGTCCCTACCATAT GAATATCCTCCTTAG serially diluted with PBS and plated on LB agar plates over- ΔfimH-R ACGTGCGTAATTTGCCGTTAATCCCAGACTTA night at 37 °C. CCGCC The adherence inhibition assay was performed by GAAGTCCCTACCATATG AATATCCTCCTTAG coincubation of the F18ac+ ETEC parent strains and cells in pBR-fimA-F CGCGGATCCATGAAAATTAAAACTCTGGCA the presence of 0.5% D-mannose. The number of adherent pBR-fimA- R CAGCGTCGACTTATTGATACTGAACCTTGA bacteria was determined as described above. pBR-fimH-F CGCGGATCCATGAAACGAGTTATTACC CTGTT pBR-fimH-R CAGCGTCGACTTATTGATAAACAAAAG Quantification of biofilm formation TCACGCC gapA-F CGTTAAAGGCGCTAACTTCG Biofilm formation in a 96-well microtiter plates assay was gapA-R ACGGTGGTCATCAGACCTTC carried out as previously described (Duan et al. 2013). fliC-F ACTCAGAAAACCTGATGGTGAAACT Briefly, overnight-grown bacterial cultures were adjusted to fliC-R CCCCACCTCTCCCTAACACA OD = 1.0 using fresh biofilm-inducing medium (Hossain fedF-F CCGTTACTCTTGATTTCTTTGTTG and Tsuyumu 2006). 150-μL culture suspensions were fedF-R GGCATTTGGGTAGTGTTTGTCTT addedtoeachwellofthe 96-wellmicrotiterplatesand AIDA-F CAGTCTACCGCACAAGCAAAAC incubated for 24 h at 30 °C statically. Non-adherent AIDA-R TCAATACACAAAACCCGATACCC bacteria in the wells were removed by washing with ddH O. Biofilm was stained with 200 μLof2%crystal violet (CV) at RT for 15 min and solubilized by 95% The full-length fimA and fimH genes were PCR-amplified ethanol for 30 min at RT. OD values were measured by a from F18ac+ ETEC genomic DNA using primers pBR-fimA- spectrophotometer (BioTek, USA). F/pBR-fimA-R and pBR-fimH-F/pBR-fimH-R, respectively (Table 2). Plasmids pBR322/fimA or pBR322/fimH were in- RNA isolation and real-time quantitative polymerase troduced into F18acΔfimA or F18acΔfimH to generate com- chain reaction (RT-PCR) plementary strains. Restoration of type I fimbriae expression in the complementary strains was verified in yeast cell agglu- Total RNA from bacterial samples was extracted using a tination and hemagglutination assays. TRIzol as previously described (Duan et al. 2013). RNA quality and yield were verified with agarose gel analy- Yeast cell agglutination assay and mannose-sensitive sis. The PrimeScript® RT Reagent Kit with gDNA hemagglutination (MSHA) test Eraser (Takara) was used to synthesize the cDNA ac- cording to the manufacturer’s protocol. Primers were The yeast cell agglutination assay was performed as previous- designed to amplify fliC, AIDA-I,and fedF genes to ly described (Müller et al. 2009). Briefly, bacteria that were target regions of unique sequences within each gene subcultured four times by serial two-fold dilution in LB broth (Table 2). PCRs were performed in triplicate with the at 37 °C under static conditions and Pichia pastoris GS115 ABI7500 instrument. All data were normalized with the were washed and resuspended to OD = 0.5 using phosphate endogenous reference gene gapA and analyzed by the −ΔΔCT buffered saline (PBS, pH7.4) with or without 0.5% D-man- 2 method. nose. Suspensions were mixed at a 1:1 (v/v) ratio. The slide was gently rotated for 5 min at room temperature (RT), while Statistical analysis monitoring for visible HA was conducted. In the MSHA as- say, 25 μL of 5% pig erythrocyte suspension with or without Each experiment was performed in triplicate and repeated at D-mannose were mixed with an equal volume of a bacterial least three times to ensure reproducibility. Data were analyzed suspension on a glass slide. The agglutination was evaluated using Student’s t-test for independent samples. Differences after being gently rotated for 5 min at RT. were considered significant if p ≤ 0.05. 796 Ann Microbiol (2017) 67:793–799 Results Characterization of ΔfimA and ΔfimH mutants and complementary strains Construction of F18ac+ ETEC mutants and the complemented strains (F18acΔfimA/pfimA and F18acΔfimH/pfimH) were verified by DNA sequencing and agglutination reactions. Unlike the parent strain, the F18acΔfimA and F18acΔfimH mutant strains lost their ability to agglutinate with yeast cells and pig erythrocytes. In contrast, the complementary strains restored their ability to agglutinate with yeast cells and pig erythrocytes in a mannose-sensitive manner like the parent strains. All strains had similar growth rate after culturing in LB brothinashakingincubator for6hat37°C(complemented strains in LB broth with Amp) (Fig. 1). Type I fimbriae mediate F18ac+ ETEC adherence to IPEC-1 and IPEC-J2 cells F18ac+ ETEC strains bind to IPEC-1 and IPEC-J2 porcine cell lines that are derived from the small intestine of newborn piglets (Duan et al. 2013). It was found that both F18acΔfimA and F18acΔfimH mutants showed reduced adherence ability to either the IPEC-1 or IPEC-J2 cell lines. Cell viable counts revealed that the F18acΔfimA mutant exhibited about 38% reduction in adherence compared to that of the parent strain, and the F18acΔfimH mutant showed about 43% reduction of adherence (Fig. 2a). In a similar way, F18acΔfimA and F18acΔfimH mutants showed 62% and 64% adherence to Fig. 2 Adherence of WT F18ac+ ETEC, isogenic mutants, and complementary strains to IPEC-1 and IPEC-J2 cells. a Adherence to IPEC-J2 cells (Fig. 2b). In contrast, F18acΔfimA/pfimA and IPEC-1 cells by WT F18ac+ ETEC, F18acΔfimA,F18acΔfimA/pfimA, F18acΔfimH/pfimH complemented strains showed similar F18acΔfimH, and F18acΔfimH/pfimH strains. b Adherence to IPEC-J2 adherence to both cell lines as the parent strains. cells by WT F18ac+ ETEC, F18acΔfimA, F18acΔfimA/pfimA, F18acΔfimH, and F18acΔfimH/pfimH strains. The adherence index of The adherence inhibition assay showed that the adherence WT strains was set as 100%. Each assay was conducted in triplicate and of wild-type F18ac+ ETEC strains to IPEC-1 and IPEC-J2 independently repeated at least three times. *Indicates statistically cells was blocked 51% and 73%, respectively, by 0.5% significant differences to the F18ac+ ETEC WT strain (p <0.05) D-mannose compared with wild-type strains. The magnitude inhibition of 8% D-mannose was not significantly different compared to that from 0.5% D-mannose (data not shown). The results indicated that type I fimbriae were involved in F18ac+ ETEC adherence to both IPEC-1 and IPEC-J2 cells in vitro. Type I fimbriae enhance F18ac+ ETEC biofilm formation F18ac+ ETEC strains formed biofilm in the 96-well micro- Fig. 1 Bacterial growth curves of F18+ enterotoxigenic Escherichia coli plates in vitro. F18acΔfimA and F18acΔfimH mutants exhib- (ETEC) wild-type (WT), mutant strains, and complementary strains. WT ited about 41% and 69% absorbance, respectively, compared F18ac+ ETEC, F18acΔfimA, F18acΔfimA/pfimA, F18acΔfimH, and to the parent strain absorbance (Fig. 3, p <0.01).In contrast, F18acΔfimH/pfimH were grown in LB broth at 37 °C for 6 h. The the biofilm formation ability of both complemented strains optical density at 600 nm (OD ) was measured hourly. The data presented are the means of four independent measurements was restored. Ann Microbiol (2017) 67:793–799 797 be helpful to develop prevention strategies. The most impor- tant pathogens causing PWD are ETEC, E. coli strains pro- ducing enterotoxins. ETEC associated with PWD produce fimbriae including K88 and F18 and enterotoxins including LT and ST (Frydendahl 2002; Zhang et al. 2007). Initial at- tachment and adherence to the host’s mucosal surface medi- ated by bacterial fimbriae is a prerequisite for PWD. Bacterial adherence is a complex and multifactorial process, which is often mediated by different adhesins (Nandre et al. 2016). F18ac fimbriae and flagella are the known adhesins involved in mediating F18ac+ ETEC adherence. It was demonstrated that the absence of F18ac fimbriae or flagella highly impairs the adherence ability of F18ac+ ETEC (Frydendahl 2002; Duan et al. 2013). Data from the current study suggest that Fig. 3 Assessment of biofilm formation of WT F18ac+ ETEC, isogenic type I fimbriae play roles in the adherence of F18ac+ ETEC mutants, and complementary strains. Biofilm biomass was spectrophotometrically measured at OD after CV staining. The 600 strains to piglet epithelial cells. experiment was performed at least three times and six replicates were Type I fimbriae are expressed by most E. coli strains and used in each single test. **Indicates statistically significant differences mediate mannose-sensitive (MS) adherence to host epithelial compared to the F18ac+ ETEC WT strain (p <0.01) cells (Iida et al. 2001). This study showed that the adherence of F18ac+ ETEC to IPEC-1 and IPEC-J2 was highly inhibited Type I fimbriae affect the expression of other adhesins with exogenous 0.5% D-mannose. However, an increase in D- mannose concentration did not lead to additional inhibition of To study whether deletion of the fimA or fimH genes affected adherence. Data from this study showed that the F18acΔfimA the expression of other adhesins for F18ac+ ETEC, quantita- and F18acΔfimH mutants had significantly lower adherence tive PCR (qPCR) was used to quantify the transcription of rates to IPEC-1 and IPEC-J2 cells compared to those of the fedF, fliC, and AIDA-I genes using gapA as a normalizing wild-type strain or the complemented strains. These results internal standard. The expression of AIDA-I was upregulated indicated that adherence roles are evident for F18+ ETEC type 2.84- and 3.37-fold in F18acΔfimA and F18acΔfimH mu- I fimbriae. However, the adherence to porcine cell lines was tants, respectively (Table 3). The deletion of fimA resulted in not completely abrogated in the type I fimbriae mutants. This 1.32- and 1.21-fold decrease in fliC and fedF expression, re- may suggest that other adhesins could be involved in mediat- spectively. Deletion of the fimH caused 1.54- and 1.17-fold ing F18ac+ ETEC adherence. decrease in fliC and fedF expression, respectively (Table 3). In Adherence ability was not significantly different between contrast to AIDA-I, these differences are not statistically the F18acΔfimA and F18acΔfimH mutants. FimH is the lectin significant. and adhesin of type I fimbriae. FimH binds to receptors con- taining terminal mannose residues and mediates agglutination of yeast and red blood cells (Schembri et al. 2000; Stahlhut Discussion et al. 2009); therefore, FimH-mediated binding can be inhibited by exogenous D-mannose. Both F18acΔfimA and PWD is one of the most common diseases in piglets. Piglets F18acΔfimH mutants lost their ability to agglutinate with develop PWD 3–10 days after weaning, which causes weight yeast cells and pig erythrocytes, indicating deficient expres- loss, slow growth, and acute death (Svensmark et al. 1989; sion of fimH in these two mutant strains. However, the mech- Verdonck et al. 2002; Vu-Khac et al. 2007). To date, there are anism by which FimA deletion impairs FimH expression is no effective prevention strategies against PWD. Therefore, still unknown. Nevertheless, the results from this study indi- cated that adhesin FimH of type I fimbriae also mediate gaining further insight to the pathogenesis of the disease can Table 3 Transcript expression of Gene Annotation Fold change in F18acΔfimA Fold change in F18acΔfimH the other potential adhesin genes mutant mutant was measured using quantitative PCR (qPCR) FliC Flagellin subunit of flagella − 1.32 − 1.54 FedF Subunit of F18 fimbriae − 1.21 − 1.17 a a AIDA-I A non-fimbriae adhesin + 2.84 +3.37 Compared to expression levels in wild-type F18ac+ ETEC. p <0.05 798 Ann Microbiol (2017) 67:793–799 F18ac+ ETEC attachment to piglet intestinal epithelium cells insights into the pathogenic mechanisms of the PWD-causing besides F18 fimbriae and flagella. F18ac+ ETEC and, perhaps, helpful information for the de- Biofilm formation facilitates firm and irreversible adhesion velopment of new strategies against F18ac+ ETEC infections. to a surface, which is highly advantageous for bacteria surviv- Notwithstanding some viewpoints which considered that type al (Koczan et al. 2011). Initial bacterial adherence to cell sur- I fimbriae contribute little, or even negatively, to pathogenicity faces is in favor of biofilm formation. Increasing evidences in vivo (May et al. 1993;Chenet al. 2003), the significance of suggest that type I fimbriae play attractive roles in the en- type I fimbriae of F18ac+ ETEC in the detailed pathogenesis hancement of biofilm formation (Nandre et al. 2012; of PWD remains to be elucidated in future studies. Grzymajło et al. 2013;Kuźmińska-Bajor et al. 2015). The Acknowledgements The authors thank Dr. Weiping Zhang for editing current study found that the F18acΔfimA and F18acΔfimH the manuscript. This study was funded by the Shaanxi Nova Program mutant strains were less effective in biofilm formation com- (2015KJXX-97) and a Weinan National Science Foundation grant pared to the F18ac+ ETEC parent strains. This study also (2013-KYJ-3). observed that the introduction of 0.5% D-mannose in the biofilm-inducing medium significantly reduced the biofilm Compliance with ethical standards formation levels of the F18ac+ ETEC parent strain. After in- Conflict of interest The authors declare that they have no competing cubation with 0.5% D-mannose, the absorbance of F18ac+ interests. ETEC parent strains was inhibited by 69% as compared with the parent strains. These results demonstrate that type I Ethical approval This article does not contain any studies with human fimbriae may play a role in enhancing F18ac+ ETEC participants or animals performed by any of the authors. biofilm formation in vitro. But whether type I fimbriae are directly involved in the biofilm formation process or indirectly down-regulate expression of other genes war- References rants further studies. Expression of surface structures in E. coli is a complex and Anderson GG, Palermo JJ, Schilling JD et al (2003) Intracellular bacterial cross-regulated process involving type I fimbriae and other biofilm-like pods in urinary tract infections. Science 301:105–107 Bien J, Sokolova O, Bozko P (2012) Role of uropathogenic Escherichia surface organelles, including P fimbriae, K88 fimbriae, and coli virulence factors in development of urinary tract infection and flagella (Holden et al. 2006; Lane et al. 2007; Zhou et al. kidney damage. Int J Nephrol 2012:681473 2013). Using RT-PCR, an up-regulation of the non-fimbrial Boudeau J, Barnich N, Darfeuille-Michaud A (2001) Type 1 pili- adhesion AIDA-I in the in vitro cultures of the above fimA and mediated adherence of Escherichia coli strain LF82 isolated from fimH deletion mutants was detected, which was in contrast to Crohn’s disease is involved in bacterial invasion of intestinal epithe- lial cells. Mol Microbiol 39:1272–1284 the gene regulations for F18ac and flagellin expressions. Casey TA, Nagy B, Moon HW (1992) Pathogenicity of porcine entero- AIDA-I is an auto-transporter protein expressed on the bacte- toxigenic Escherichia coli that do not express K88, K99, F41, or rial outer membrane and appears to mediate bacterial initial 987P adhesins. Am J Vet Res 53:1488–1492 adherence and biofilm formation in vitro (Ravi et al. 2007). In Chen YM, Wright PJ, Lee CS et al (2003) Uropathogenic virulence fac- tors in isolates of Escherichia coli from clinical cases of canine order to save energy and survive in vivo, bacteria predomi- pyometra and feces of healthy bitches. Vet Microbiol 94:57–69 nantly produce specific type fimbriae during the infection pro- Croxen MA, Finlay BB (2010) Molecular mechanisms of Escherichia cess (Croxen and Finlay 2010). For F18ac+ ETEC, specific coli pathogenicity. Nat Rev Microbiol 8:26–38 F18ac fimbriae are the predominant adhesins. This may ex- Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal plain why type I fimbriae play a minor role in the F18ac+ genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640–6645 ETEC adherence in vivo. It was found that AIDA-I and de la Fé Rodríguez PY, Coddens A, Del Fava E et al (2011) High prev- F18ac fimbriae are governed on the same plasmid (Mainil alence of F4+ and F18+ Escherichia coli in Cuban piggeries et al. 2002), but they could be regulated differently in the as determined by serological survey. Trop Anim Health Prod mutant strains. The exact mechanism of cross-regulation be- 43:937–946 tween type I fimbriae and other adhesion factors needs to be Duan QD, Zhou MX, Zhu XF et al (2013) Flagella from F18+ Escherichia coli play a role in adhesion to pig epithelial cell lines. further investigated. Microb Pathog 55:32–38 In conclusion, the present study demonstrated that type I Fairbrother JM, Nadeau É, Gyles CL (2005) Escherichia coli in post- fimbriae contribute to the adherence of F18ac+ ETEC to por- weaning diarrhea in pigs: an update on bacterial types, pathogenesis, cine intestinal epithelial cells and the early phases of biofilm and prevention strategies. Anim Health Res Rev 6:17–39 Frydendahl K (2002) Prevalence of serogroups and virulence genes in formation in vitro. Additionally, there may be regulatory Escherichia coli associated with postweaning diarrhoea and edema cross-links among F18ac+ ETEC adhesins, including type I disease in pigs and a comparison of diagnostic approaches. Vet fimbriae and AIDA-I adhesin. As the adherence of F18ac+ Microbiol 85:169–182 ETEC to piglet epithelial cells is considered a crucial and Grzymajło K, Ugorski M, Kolenda R et al (2013) FimH adhesin from initial step of pathogenesis, the results from this study provide host unrestricted Salmonella enteritidis binds to different Ann Microbiol (2017) 67:793–799 799 glycoprotein ligands expressed by enterocytes from sheep, pig and implanted into the bladders of mice as a model of catheter-associated urinary tract infections. Infect Immun 81:3009–3017 cattle than FimH adhesins from host restricted Salmonella abortus- ovis, Salmonella choleraesuis and Salmonella dublin. Vet Microbiol Nandre RM, Matsuda K, Chaudhari AA et al (2012) A genetically 166:550–557 engineered derivative of Salmonella Enteritidis as a novel Holden NJ, Totsika M, Mahler E et al (2006) Demonstration of regulatory live vaccine candidate for salmonellosis in chickens. Res cross-talk between P fimbriae and type 1 fimbriae in uropathogenic Vet Sci 93(2):596–603 Escherichia coli. Microbiology 152:1143–1153 Nandre RM, Ruan X, Duan Q et al (2016) Antibodies derived from an Hossain MM, Tsuyumu S (2006) Flagella-mediated motility is required enterotoxigenic Escherichia coli (ETEC) adhesin tip MEFA for biofilm formation by Erwinia carotovora subsp. carotovora. (multiepitope fusion antigen) against adherence of nine ETEC Gen Plant Pathol 72:34–39 adhesins:CFA/I,CS1,CS2,CS3,CS4,CS5, CS6,CS21and Iida KI, Mizunoe Y, Wai SN et al (2001) Type 1 fimbriation and its phase EtpA. Vaccine 34(31):3620–3625 switching in diarrheagenic Escherichia coli strains. Clin Diagn Lab Orndorff PE, Falkow ST (1984) Organization and expression of genes Immunol 8:489–495 responsible for type 1 piliation in Escherichia coli. J Bacteriol 159: Jouve M, Garcia MI, Courcoux P et al (1997) Adhesion to and invasion of 736–744 HeLa cells by pathogenic Escherichia coli carrying the afa-3 gene Rausch D, Ruan X, Nandre R et al (2017) Antibodies derived from a cluster are mediated by the AfaE and AfaD proteins, respectively. toxoid MEFA (multiepitope fusion antigen) show neutralizing activ- Infect Immun 65:4082–4089 ities against heat-labile toxin (LT), heat-stable toxins (STa, STb), and Klemm P (1984) The fimA gene encoding the type I fimbrial subunit of Shiga toxin 2e (Stx2e) of porcine enterotoxigenic Escherichia coli Escherichia coli: nucleotide sequence and primary structure of the (ETEC). Vet Microbiol 202:79–89 protein. Eur J Biochem 143:395–399 Ravi M, Ngeleka M, Kim SH et al (2007) Contribution of AIDA-I to the Klemm P, Christiansen G (1987) Three fim genes required for the regu- pathogenicity of a porcine diarrheagenic Escherichia coli and to lation of length and mediation of adhesion of Escherichia coli type 1 intestinalcolonization through biofilm formation in pigs. Vet fimbriae. Mol Gen Genet 208:439–445 Microbiol 120:308–319 Koczan JM, Lenneman BR, McGrath MJ et al (2011) Cell surface attach- Schembri MA, Sokurenko EV, Klemm P (2000) Functional flexibility of ment structures contribute to biofilm formation and xylem coloniza- the FimH adhesin: insights from a random mutant library. Infect tion by Erwinia amylovora. Appl Environ Microbiol 77:7031–7039 Immun 68:2638–2646 Krogfelt KA, Bergmans H, Klemm P (1990) Direct evidence that the Stahlhut SG, Tchesnokova V, Struve C et al (2009) Comparative struc- FimH protein is the mannose-specific adhesin of Escherichia coli ture–function analysis of mannose-specific FimH adhesins from type 1 fimbriae. Infect Immun 58:1995–1998 Klebsiella pneumoniae and Escherichia coli. J Bacteriol 191: Kuźmińska-Bajor M, Grzymajło K, Ugorski M (2015) Type 1 fimbriae 6592–6601 are important factors limiting the dissemination and colonization of Svensmark B, Jorsal SE, Nielsen K et al (1989) Epidemiological studies mice by Salmonella Enteritidis and contribute to the induction of of piglet diarrhoea in intensively managed Danish sow herds. I. Pre- intestinal inflammation during Salmonella invasion. Front weaning diarrhoea. Acta Vet Scand 30:43–53 Microbiol 6:276 Verdonck F, Cox E, van Gog K et al (2002) Different kinetic of antibody Lane MC, Simms AN, Mobley HL (2007) Complex interplay between responses following infection of newly weaned pigs with an F4 type 1 fimbrial expression and flagellum-mediated motility of enterotoxigenic Escherichia coli strain or an F18 verotoxigenic uropathogenic Escherichia coli. J Bacteriol 189:5523–5533 Escherichia coli strain. Vaccine 20:2995–3004 Mainil JG, Jacquemin E, Pohl P et al (2002) DNA sequences Vu-Khac H, Holoda E, Pilipcinec E et al (2007) Serotypes, virulence coding for the F18 fimbriae and AIDA adhesin are localised genes, intimin types and PFGE profiles of Escherichia coli isolated on the same plasmid in Escherichia coli isolates from piglets. from piglets with diarrhoea in Slovakia. Vet J 174:176–187 Vet Microbiol 86:303–311 Wiles TJ, Kulesus RR, Mulvey MA (2008) Origins and virulence mech- May AK, Bloch CA, Sawyer RG et al (1993) Enhanced virulence of anisms of uropathogenic Escherichia coli. Exp Mol Pathol 85:11–19 Escherichia coli bearing a site-targeted mutation in the major struc- Zhang W, Zhao M, Ruesch L et al (2007) Prevalence of virulence genes in tural subunit of type 1 fimbriae. Infect Immun 61:1667–1673 Escherichia coli strains recently isolated from young pigs with di- Müller CM, Åberg A, Straseviçiene J et al (2009) Type 1 fimbriae, a arrhea in the US. Vet Microbiol 123:145–152 colonization factor of uropathogenic Escherichia coli,arecontrolled by the metabolic sensor CRP-cAMP. PLoS Pathog 5:e1000303 Zhou M, Duan Q, Zhu X et al (2013) Both flagella and F4 fimbriae from Murphy CN, Mortensen MS, Krogfelt KA et al (2013) Role of Klebsiella F4ac+ enterotoxigenic Escherichia coli contribute to attachment to pneumoniae type 1 and type 3 fimbriae in colonizing silicone tubes IPEC-J2 cells in vitro. Vet Res 44:30
Journal
Annals of Microbiology – Springer Journals
Published: Oct 24, 2017