Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Autophagy inhibition in 3T3-L1 adipocytes breaks the crosstalk with tumor cells by suppression of adipokine production

Autophagy inhibition in 3T3-L1 adipocytes breaks the crosstalk with tumor cells by suppression of... MOLECULAR CELLULAR BIOLOGY ANIMAL CELLS AND SYSTEMS 2020, VOL. 24, NO. 1, 17–25 https://doi.org/10.1080/19768354.2019.1700159 Autophagy inhibition in 3T3-L1 adipocytes breaks the crosstalk with tumor cells by suppression of adipokine production Sung-Hee Hwang and Michael Lee Division of Life Sciences, College of Life Sciences and Bioengineering, Incheon National University, Incheon, Republic of Korea ABSTRACT ARTICLE HISTORY Received 26 July 2019 Several studies have revealed the functional importance of autophagy in both adipogenesis and Revised 31 October 2019 carcinogenesis. Here, we investigated autophagy as a link between tumorigenesis and Accepted 28 November 2019 adipogenesis using 3T3-L1 cells, which have been shown to closely mimic the in vivo differentiation process. The relative levels of LC3-II/I showed that autophagy was the highest KEYWORDS after 4–6 days of initiation of differentiation and it diminished thereafter. Furthermore, Adipocytes; adipokines; chloroquine (CQ), a late autophagy inhibitor, effectively inhibited adipogenic differentiation of autophagy; chloroquine; 3T3-L1 cells, suggesting that autophagy may have a positive impact on adipogenic tumors differentiation. Notably, real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis showed that CQ completely blocked the mRNA expression of three adipokines (adiponectin, leptin, and peroxisome proliferator-activated receptor-γ (PPARγ)), which increased proportionally to adipocyte differentiation. Using adipokine antibody arrays, we also found that among 38 adipokines examined, 6 adipokines were significantly differentially regulated in mature adipocytes compared to those in preadipocytes. A comparative analysis of adipokine production revealed that CQ-treated adipocytes displayed a profile similar to that of preadipocytes. Subsequently, CQ treatment significantly inhibited the migration capacity of v-Ha- ras-transformed cells in both 3T3-L1 adipocyte-conditioned medium and co-culture with 3T3-L1 using a transwell plate. Taken together, our results suggest that autophagy inhibition blocks the production of mediators relevant to the adipogenic process and may significantly contribute to reducing obesity-related cancer risk. Introduction adipocytes (Yoshizaki et al. 2012). Thus, the link between autophagy and cellular program of adipogen- Obesity is increasing worldwide and is a well-known risk esis remains to be further defined. factor for several cancers (De Pergola and Silvestris 2013). Besides its contrasting role in adipocyte differen- However, its underlying mechanism is not yet well tiation, autophagy also has opposing, context-depen- understood. Adipose-secreted adipokines might be one dent roles in cancer (Levy et al. 2017). Autophagy has of the underlying factors that have been suggested to been known to function as a tumor suppressor by explain the association between obesity and increased removing damaged organelles/proteins and limiting risk of certain cancers (Gui et al. 2017). Moreover, a pre- cell growth (Mathew et al. 2009). In contrast, other evi- vious study demonstrated that adipokines from mature dence indicates that the predominant role of autophagy adipocytes exhibited the ability to promote cell growth, in cancer cells is to maintain tumor cell survival (Degen- motility, and invasion of breast cancer cells in vitro hardt et al. 2006). Our previous studies also showed that (Iyengar et al. 2003). autophagy could play a dual role in either pro-cell survi- It has been reported that autophagy is critical for lipid val or pro-cell death in response to anticancer drugs accumulation and adipocyte differentiation factors (Hwang et al. 2018). (Jansen et al. 2012). Genetic disruption of autophagy- In this study, we investigated autophagy as a link related genes significantly impedes adipogenesis in cul- between tumorigenicity and adipocyte differentiation. tured preadipocytes and in mice (Baerga et al. 2009). On The 3T3-L1 cell line, which is used extensively as an in the other hand, there is a contrasting report that autop- vitro model to generate adipocyte-like cells, was used hagy is downregulated in the adipose tissue derived as the adipocyte differentiation model. Our study from high fat-fed mice and in hypertrophic 3T3-L1 CONTACT Michael Lee mikelee@inu.ac.kr Division of Life Sciences, College of Life Sciences and Bioengineering, Incheon National University, Incheon 22012, Republic of Korea © 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 18 S.-H. HWANG AND M. LEE revealed that autophagy is specifically required for the 510 nm using a SpectraMax 190 Microplate Reader (Mol- initial stage of adipogenic differentiation. Furthermore, ecular Devices, Sunnyvale, CA, USA). our results suggested that autophagy might regulate adi- pogenesis and carcinogenesis via crosstalk with adipo- Autophagy monitoring assay by conversion of kines secreted by adipocytes. Thus, the results of our LC3 report could contribute to the development of auxiliary therapy against obesity-related cancer risk. Autophagy was measured by the conversion of LC3-I to LC3-II by immunoblot analysis as previously (Hwang et al. 2018). Detection was achieved using the Bio-Rad Materials and methods ChemiDoc XRS+ instrument (Hercules, CA, USA), and Reagents and antibodies the data were visualized using the Bio-Rad Image Lab software version 5.2.1 (Bio-Rad Laboratories). Proteome Profiler Mouse Adipokine Array Kit (Catalog # ARY013) was purchased from R&D Systems (Minneapolis, MN, USA). Dulbecco’s modified Eagle’s medium (DMEM), Cell viability assay and fetal bovine serum (FBS) were purchased from The cells were seeded in quadruplicate in 96-well micro- Thermo Fisher Scientific (Carlsbad, CA, USA). Insulin, 3- titer plates (Costar, Cambridge, MA, USA) at a density of isobutyl-1-methylxanthine (IBMX), dexamethasone 5×10 cells/well and then incubated at 37°C in a (DEX), Oil Red O dye, and chloroquine (CQ) were pur- humidified 5% CO /95% air incubator. On the indicated chased from Sigma–Aldrich (St. Louis, MO, USA). days, the cells were incubated with WST-1 reagent at 37°C for 3 h. The absorbance of the samples against a background control (medium alone), which served as a Cell lines and culture conditions blank, was measured at 450 nm using a SpectraMax Murine preadipocyte (3T3-L1) cells were purchased from 190 microplate reader. the American Type Culture Collection (Manassas, VA, USA). 3T3-L1 preadipocytes were cultured in DMEM- F12 supplemented with 10% FBS and kept at 37°C in a Real-time quantitative reverse transcription-PCR 5% CO incubator. The 3T3-L1 cells used for all following 2 (qPCR) analysis investigations were of low passage number and were Total RNA isolation, reverse transcription, and PCR reac- routinely subdivided at <70% confluence. The v-Ha-ras- tion were performed as described previously (Kim et al. transformed NIH3T3 (Ras-NIH3T3) cells were maintained 2017). All primers were synthesized by Bioneer at 37°C in DMEM supplemented with 10% FBS. (Daejeon, Korea). The primer sequences used for the qPCR analysis are listed in Table 1. The real-time PCR data were normalized for differences in β-actin levels Differentiation of 3T3-L1 cells and oil red O −ΔΔCt by analysis with the 2 method. staining For adipocyte differentiation, 3T3-L1 preadipocytes were seeded in 48-well culture plates (1.5 × 10 cells/well) and Proteome Profiler™ adipokine array analysis grown to confluence. Differentiation of 2-day post- Proteome Profiler Mouse Adipokine Array Kits were used confluent preadipocytes (designated as day 0) was to simultaneously detect the relative expression levels of initiated with medium containing MDI (10 μg/mL 38 adipokines using protein lysates from 3T3-L1 adipo- insulin, 1 μM DEX, and 0.5 mM IBMX) in DMEM-F12 cytes. The array was performed according to the manu- with 10% FBS. Three days later, the medium was facturer’s instructions. Briefly, protein (250 μg) was replaced with DMEM-F12 containing 10% FBS and incubated overnight with the adipokine antibody cock- 10 μg/mL insulin. Another 2 days later, the medium tail. The antigen–antibody reaction was detected by che- was changed to DMEM-F12 + 10% FBS. Differentiated miluminescent detection substrate (Thermo Fisher cells were used for functional assays on days 8–9 after Scientific, Rockford, IL, USA) and images were captured differentiation was initiated. In vitro, differentiated cells were fixed for 20 min in buffered formalin and stained Table 1. Primer sequence for real-time quantitative PCR analysis. with Oil Red O for 3 h. For the quantification of lipid dro- ′ ′ ′ ′ Genes Forward primer (5 -3 ) Reverse primer (5 -3 ) plets, stained cells were dried completely and extracted Adiponectin GTGCAGGTTGGATGGCAGGCA CAGTGACGCGGGTCTCCAGC with isopropanol (0.5 mL/well of a 24-well plate). The Leptin CCCTGTGGAGGTGAGCGGGA CCAGCCACCACGAGCCTTCG PPARγ GCCTTCGCTGATGCACTGCC CAGCAACCATTGGGTCAGCTCT optical density of the extracted dye was measured at ANIMAL CELLS AND SYSTEMS 19 by a Molecular imager (Bio-Rad). Densitometric analysis In vitro cell migration assay of immunoreactions on the captured image was per- An in vitro cell migration assay was carried out using a formed by Image Lab software version 5.2.1 (Bio-Rad). 24-well transwell culture system as described pre- viously (Hwang et al. 2018). For quantitation, the crystal violet dye retained on the filters was acid Culture of Ras-NIH3T3 cells in adipocyte- extracted, and cell migration was measured by conditioned medium reading the absorbance at 550 nm. Each experiment was performed in triplicate. When 3T3-L1 adipocytes were differentiated to day 12 in the absence and presence of CQ, the medium was replaced with 1% FBS/DMEM for 24 h. The supernatants Results were collected and used as an adipocyte-conditioned medium (Ad-CM) for subsequent in vitro studies. To The role of autophagy in 3T3-L1 adipocyte test the effect of Ad-CM on the growth of Ras-NIH3T3 differentiation cells, different concentrations of Ad-CM were prepared Differentiation of 3T3-L1 preadipocytes into adipocytes in a fresh 1% FBS/DMEM medium. was monitored by staining with the neutral lipid- specific dye Oil Red O, which reveals the formation of visible lipid droplets. As shown in Figure 1A, 3T3-L1 Co-culture of Ras-NIH 3T3cells with 3T3-L1 cells treated with MDI readily differentiated into morpho- adipocytes logically distinct fat-laden adipocytes. To reveal the role To mimic the physiological environment of the obesity- of autophagy during differentiation of 3T3-L1 preadipo- related tumor, Ras-NIH3T3 cells and 3T3-L1 adipocytes cytes, we measured LC3-I to LC3-II conversion, which is were co-cultured using a transwell culture system a good indicator of autophagy. The relative levels of (0.4 mm pore size). Firstly, 3T3-L1 cells were seeded in LC3-II/I showed that autophagy reached a maximum 6-well plates and differentiated into adipocytes in the after 4–6 days of initiation of differentiation and dimin- absence and presence of CQ until day 12. Ras-NIH3T3 ished thereafter (Figure 1B). In addition, treatment with cells were seeded in the upper chamber of a 6-well trans- CQ, which is known to inhibit the fusion of autophago- well culture system at a density of 4.25 × 10 cells/well some with lysosome (Kimura et al. 2013), impaired differ- and co-cultivated with or without mature adipocytes in entiation of 3T3-L1 cells (Figure 2A and B). These data the lower chamber. Ras-NIH3T3 cells cultivated alone in collectively suggest that autophagy may have a positive similar conditions served as controls. impact on adipogenic differentiation. Figure 1. Autophagy induction during adipocyte differentiation of 3T3-L1 preadipocytes. (A) Morphological evidence of adipocyte differ- entiation at day 9 of the conversion process was monitored by the appearance of fat droplets utilizing light microscopy after oil red O staining. (B) At −3, 0, 2, 4, 6, 8 and 10 days after initiation of differentiation, the change in the electrophoretic mobility of LC3 from a non-autophagic (LC3-I) form to an autophagic membrane-recruited (LC3-II) form was determined by immunoblotting. β-Actin expression was assessed as protein loading control. The presented results are representative of at least three independent experiments. 20 S.-H. HWANG AND M. LEE Figure 2. The effect of the late-stage autophagy inhibitor chloroquine on 3T3-L1 adipocyte differentiation. The 3T3-L1 preadipocytes were treated with 10 μMCQindifferentiation medium for 3 days before being switched to insulin medium. (A) A representative image of Oil Red O staining of cells at day 9. (B) Left, A representative image of a 6-well plates stained with Oil Red O at day 9; Right, Quantifi- cation of Oil Red O staining (n = 3/treatment). Late-stage autophagy inhibitor chloroquine In addition, Proteome Profiler mouse adipokine anti- affects the production of adipokines body arrays were performed to identify the differentially expressed adipokines in differentiated adipocytes. Adipokines secreted by the adipose tissue play an important Figure 4A depicts images of chemiluminescent reaction role in adipocyte differentiation (Hauner 2005). Thus, we spots that represent the expression of 38 adipokines in investigated whether autophagy is also closely linked to 3T3-L1 cells. Among 38 adipokines examined, we found adipokine production. Among the adipokines, leptin, adipo- 6 adipokines (adiponectin, lipocalin-2, resistin, VEGF, nectin, and PPARγ arecurrently themostprominent dueto leptin, and serpin E1/PAI-1) that were significantly differ- their functions in the regulation of adipogenesis (Deng and entially regulated in mature adipocytes compared to Scherer 2010). The qPCR assay revealed that the expressions those in preadipocytes (Figure 4B). CQ-treated adipo- of three adipokine mRNA were first detected on day 3 of cytes displayed a profile similar to that of preadipocytes, initiation of differentiation and then increased progressively with a significant reduction of adiponectin, lipocalin-2, as the cells acquired a terminally differentiated phenotype resistin, and VEGF expression, but only a minor effect (Figure 3). Notably, CQ completely blocked the increase of on leptin. Interestingly, serpin E1/PAI-1 was downregu- mRNA expression of these adipokines in 3T3-L1 cells lated in differentiated cells but recovered to its normal during MDI-induced adipocyte differentiation. level after CQ treatment. These observations suggest ANIMAL CELLS AND SYSTEMS 21 Figure 3. The effect of chloroquine on adipokine mRNA expression during 3T3-L1 adipocyte differentiation. Total RNA was isolated from 3T3-L1 cells at 1, 3, 4, 7, 11, and 14 days after initiation of differentiation in the presence or absence of 10 μM CQ. The mRNA levels of three adipokines (adiponectin, leptin, and PPARγ) were measured by real-time qRT-PCR. For quantitative analysis of gene −ΔΔCt expression, the comparative threshold cycle (Ct) method for relative quantification (2 ) was used. The expression of the target genes was normalized to β-actin expression. Values represent the mean ± standard deviation (SD) of quadruplicate determinants from one of three representative experiments. **p < .01 compared to preadipocytes, as determined by Dunnett’s test. that autophagy modulates several key factors of adipo- was significantly increased by 39% (p < 0.01) (Figure genic differentiation. 5C). The migration capacity was somewhat greater in Ras-NIH3T3 cells co-cultivated with mature adipocytes, although it was statistically insignificant (Figure 5D). Chloroquine breaks the crosstalk between Ras- However, the migration capacity of Ras-NIH3T3 cells NIH3T3 cells and adipocytes was greatly suppressed when co-cultivated with 3T3- Adipokines secreted from mature adipocytes might be L1 cells treated with CQ. These results suggest that one of the factors that have been suggested to impaired autophagy deregulates the production of adi- explain the association between obesity and increased pokines relevant to the adipogenic process, and may risk of certain cancers (Gui et al. 2017). Thus, we evalu- significantly contribute to the migration capacity of ated the effect of Ad-CM on Ras-NIH3T3 cells, which tumor cells. clearly show morphologically transformed foci of cells. Ras-NIH3T3 cells were cultured for 48 h in 1%, 5%, Discussion 10%, and 50% Ad-CM in fresh complete medium. Ad- CM exerted no effect on the viability of Ras-NIH3T3 Autophagy may play a crucial role in modulating adipo- cells, regardless of CQ treatment, as compared to cells genic differentiation (Jansen et al. 2012), provoking a cultured in normal media (Figure 5A). However, cell considerable interest in the possibility of targeting migration assay showed that CQ-treated Ad-CM autophagy for the prevention and treatment of greatly abrogated the migration capacity of Ras- obesity-related diseases. In this study, we found that NIH3T3 cells (Figure 5B). Next, to mimic the physiologi- the relative levels of LC3-II/I were increased most signifi- cal environment of obesity-related cancer, Ras-NIH3T3 cantly on days 4–6 after initiation of adipogenic differen- cells were co-cultured using a transwell culture tiation and then returned to normal levels thereafter. system with differentiated 3T3-L1 cells. After co-cultiva- Consistent with our results, it has been reported that tion with 3T3-L1 cells, the viability of Ras-NIH3T3 cells autophagy is essential and most active during the 22 S.-H. HWANG AND M. LEE Figure 4. Chloroquine modulates adipokine production in 3T3-L1 adipocytes. 3T3-L1 preadipocytes were differentiated to day 7 into mature adipocytes in the presence or absence of 10 μM CQ. The cell lysates from preadipocytes and mature adipocytes were assessed for adipokine expression using an antibody adipokine array. In (A), images of chemiluminescent reaction spots on adipokine profiler membranes representing the expression of various adipokines in 3T3-L1 cells differentiated in the presence and absence of 30 μM of CQ. In (B), a comparative expression of adipokines (in arbitrary units) obtained from densitometric analysis of the chemiluminescent reaction spots is tabulated. initial stage of adipocyte differentiation, but it is dispen- LAP) has been reported to promote early adipogenic sable during the later stages (Skop et al. 2014). We used differentiation by directly activating expression of CQ, which is currently the most widely used autophagy PPARγ2 (Lechner et al. 2013). Several studies have used inhibitor, to block autophagy in 3T3-L1 preadipocytes. RNA-Seq analysis to investigate the genes related to adi- In particular, CQ is the only clinically available autophagy pogenesis, some of which have been associated with inhibitors approved by the US Food and Drug Adminis- tumorigenesis. The RNA-Seq study by Mangiola et al. tration (Mauthe et al. 2018). Although the type III PI3K (2018) suggests that periprostatic adipose tissue from inhibitor 3-MA was the first identified inhibitor of autop- patients with high-risk prostate cancer has a distinct tran- hagy, a recent study presents a finding that 3-MA could scriptional signature, which was confirmed by qPCR in an promote autophagy under nutrient-rich conditions for a expanded cohort. In particular, Leptin and Wnt have prolonged period (Wu et al. 2010). Our results revealed been demonstrated as the top two transcripts elevated that, when treated with CQ, 3T3-L1 cells exhibited drasti- in mouse high fat diet colon shared with tumors, using cally reduced the efficiency of adipocyte differentiation. next generation RNA sequencing and pathway analysis These data collectively suggest that autophagy may (Penrose et al. 2017). have a positive impact on adipogenic differentiation. Adipokines secreted from mature adipocytes might be However, the precise mechanisms by which autophagy one of the factors that have been suggested to explain induces adipogenic differentiation are poorly under- the association between obesity and increased risk of stood. An intriguing hypothesis is that autophagy certain cancers (Gui et al. 2017). Here, we evaluated increases the stability of PPARγ2, the key regulator of adi- the role of autophagy in the expression of three adipo- pogenesis (Zhang et al. 2013). In addition, the full-length kines (adiponectin, leptin, and PPARγ), which are cur- isoform of CCAAT enhancer binding protein β (C/EBPβ- rently the most prominent due to their functions in ANIMAL CELLS AND SYSTEMS 23 Figure 5. Chloroquine breaks the crosstalk between Ras-NIH 3T3 cells and adipocytes. (A and B) Ad-CM was collected from 3T3-L1 adipocytes that were differentiated to day 12 in the absence and presence of CQ. In (A), Ras-NIH 3T3 cells were cultured in the presence of increasing concentrations of Ad-CM for 48 h. Cell viability was then evaluated using WST-1 reagent. The values represent mean ± SD of quadruplicates from one of three representative experiments. In (B), Ras-NIH 3T3 cells were incubated for 4 h in 10% Ad-CM, and then migration was measured in vitro using transwell system. One representative data were presented. n =3; *p < .05 compared to cells cultured in normal Ad-CM. (C and D) Ras-NIH 3T3 cells were co-cultured with adipocytes that were differentiated in the presence or absence of CQ for 48 h using a transwell system. In (C), Ras-NIH 3T3 cells were trypsinized and cell viability was evaluated using WST-1 reagent. The values represent mean ± SD of quadruplicates from one of three representative experiments. In (D), the migration capacity of Ras-NIH 3T3 cells was measured in vitro using transwell system. One representative data were presented. n =3; **p < .01 and *p < .05 compared to cells grown alone. the regulation of adipogenesis (Deng and Scherer 2010). increased in 3T3-L1 adipocytes, although it has been The real-time qRT-PCR analysis showed that the reported that adiponectin characteristically differs from expression of these three adipokines increased propor- most adipokines as it is negatively correlated with tionally to adipocyte differentiation. In addition, adipo- obesity (Shehzad et al. 2012). However, unlike the kine antibody array showed that among 38 adipokines results obtained in qRT-PCR analysis, no significant examined, 5 adipokines were upregulated during differ- increase in leptin level was observed in adipokine anti- entiation of 3T3-L1 preadipocytes into adipocytes, with body arrays. Norman et al. (2003) reported that differen- a time-course comparable to that of other adipocyte tiated 3T3-L1 adipocytes express only small amounts of markers. These five adipokines included adiponectin, leptin. Interestingly, we observed that serpin E1/PAI, lipocalin-2, resistin, leptin, and VEGF. In particular, lipo- which has well-documented pro-tumorigenic functions calin-2 and resistin levels were most dramatically (Fang et al. 2012), was downregulated in differentiated increased in parallel with adipocyte differentiation. 3T3-L1 adipocytes. Our findings are consistent with Recently, it has been reported that resistin is upregu- those of Liang et al. (2006), in which serpin E1/PAI-1 lated in patients with breast cancer and promotes deficiency promoted adipocyte differentiation. As breast cancer cell growth, invasion, and migration (Lee expected, CQ-treated cells displayed an adipokine et al. 2016). Lipocalin-2 (NGAL) was found to attenuate profile similar to that of preadipocytes. Five upregulated autophagy to exacerbate cardiac apoptosis induced by adipokines returned to their original levels when treated myocardial ischemia (Sung et al. 2017). Unexpectedly, with CQ. The serpin E1/PAI-1 also returned to its original we found that adiponectin expression was significantly level when treated with CQ. 24 S.-H. HWANG AND M. LEE promotes tumor cell survival and restricts necrosis, inflam- Subsequently, the culture of Ras-NIH3T3 cells in 3T3- mation, and tumorigenesis. Cancer Cell. 10:51–64. L1 Ad-CM and co-culture of 3T3-L1 and Ras-NIH3T3 Deng Y, Scherer PE. 2010. Adipokines as novel biomarkers and cells using a transwell plate were performed to clarify regulators of the metabolic syndrome. Ann N Y Acad Sci. the relationship between adipocytes and tumor cells. 1212:E1–E19. Ad-CM exerted no effect on both the proliferative De Pergola G, Silvestris F. 2013. Obesity as a major risk factor for ability and migration capacity of Ras-NIH3T3 cells. cancer. J Obes. 2013. 291546. Fang H, Placencio VR, DeClerck YA. 2012. Protumorigenic However, our co-culture system showed that Ras- activity of plasminogen activator inhibitor-1 through an anti- NIH3T3 cells co-cultivated with mature 3T3-L1 adipo- apoptotic function. J Natl Cancer Inst. 104:1470–1484. cytes exhibited enhanced migration, suggesting that Gui Y, Pan Q, Chen X, Xu S, Luo X, Chen L. 2017. The association mature adipocytes are able to stimulate the migration between obesity related adipokines and risk of breast cancer: capacities of cancer cell lines. Co-culture with adipocytes a meta-analysis. Oncotarget. 8:75389–75399. Hauner H. 2005. Secretory factors from human adipose tissue also has an enhancing effect on Ras-NIH3T3 cell prolifer- and their functional role. Proc Nutr Soc. 64:163–169. ation. Conversely, CQ treatment significantly inhibited Hwang S-H, Han B-I, Lee M. 2018. Knockout of ATG5 leads to the migration capacity of Ras-NIH3T3 cells in both the malignant cell transformation and resistance to Src family Ad-CM model and the co-culture system. In particular, kinase inhibitor PP2. J Cell Physiol. 233:506–515. these results suggest that the deregulation of adipokine Iyengar P, Combs TP, Shah SJ, Gouon-Evans V, Pollard JW, levels in adipocytes after CQ treatment might contribute Albanese C, Flanagan L, Tenniswood MP, Guha C, Lisanti MP, et al. 2003. Adipocyte-secreted factors synergistically to the suppressed migration capacity of tumor cells. This promote mammary tumorigenesis through induction of may probably be due to the difference of expression anti-apoptotic transcriptional programs and proto-oncogene ratio relative to each of the other adipokines, rather stabilization. Oncogene. 22:6408–6423. than of the absolute expression level of each adipokine Jansen HJ, van Essen P, Koenen T, Joosten LA, Netea MG, Tack between control and CQ-treated adipocytes. CJ, Stienstra R. 2012. Autophagy activity is up-regulated in adipose tissue of obese individuals and modulates proi- Taken together, our results revealed that autophagy is nflammatory cytokine expression. Endocrinology. essential and most active during the initial stage of adi- 153:5866–5874. pocyte differentiation, but it is dispensable during the Kim JH, Ahn JH, Lee M. 2017. Upregulation of MicroRNA-1246 is later stages. More importantly, CQ treatment blocked associated with BRAF inhibitor resistance in Melanoma cells the production of mediators relevant to the adipogenic with Mutant BRAF. Cancer Res Treat. 49:947–959. process in the co-culture system, and might significantly Kimura T, Takabatake Y, Takahashi A, Isaka Y. 2013. Chloroquine in cancer therapy: a double-edged sword of autophagy. contribute to the suppression of obesity-related cancer Cancer Res. 73:3–7. development. These results suggest that CQ broke the Lechner S, Mitterberger MC, Mattesich M, Zwerschke W. 2013. crosstalk between these two cell lines, possibly contri- Role of C/EBPβ-LAP and C/EBPβ-LIP in early adipogenic differ- buting to its chemopreventive properties in cancer. entiation of human white adipose-derived progenitors and at Thus, in future studies on the effects of obesity and sub- later stages in immature adipocytes. Differentiation. 85:20–31. Lee JO, Kim N, Lee HJ, Lee YW, Kim SJ, Park SH, Kim HS. 2016. sequent alterations in adipokine expression in tumor Resistin, a fat-derived secretory factor, promotes metastasis cells, it is important to verify the role of autophagy as a of MDA-MB-231 human breast cancer cells through ERM acti- potential therapeutic target. vation. Sci Rep. 6:18923. Levy JMM, Towers CG, Thorburn A. 2017. Targeting autophagy in cancer. Nat Rev Cancer. 17:528–542. Disclosure statement Liang X, Kanjanabuch T, Mao SL, Hao CM, Tang YW, Declerck PJ, Hasty AH, Wasserman DH, Fogo AB, Ma LJ. 2006. Plasminogen No potential conflict of interest was reported by the authors. activator inhibitor-1 modulates adipocyte differentiation. Am J Physiol Endocrinol Metab. 290:E103–E113. Mangiola S, Stuchbery R, Macintyre G, Clarkson MJ, Peters JS, Funding Costello AJ, Hovens CM, Corcoran NM. 2018. Periprostatic fat tissue transcriptome reveals a signature This research was supported by the Incheon National University diagnostic for high-risk prostate cancer. Endocr Relat Research Grant in 2018. Cancer. 25:569–581. Mathew R, Karp CM, Beaudoin B, Vuong N, Chen G, Chen HY, Bray K, Reddy A, Bhanot G, Gelinas C, et al. 2009. References Autophagy suppresses tumorigenesis through elimination of p62. Cell. 137:1062–1075. Baerga R, Zhang Y, Chen PH, Goldman S, Jin S. 2009. Targeted Mauthe M, Orhon I, Rocchi C, Zhou X, Luhr M, Hijlkema KJ, deletion of autophagy-related 5 (atg5) impairs adipogenesis Coppes RP, Engedal N, Mari M, Reggiori F. 2018. in a cellular model and in mice. Autophagy. 5:1118–1130. Chloroquine inhibits autophagic flux by decreasing autopha- Degenhardt K, Mathew R, Beaudoin B, Bray K, Anderson D, Chen gosome-lysosome fusion. Autophagy. 14:1435–1455. G, Mukherjee C, Shi Y, Gélinas C, Fan Y, et al. 2006. Autophagy ANIMAL CELLS AND SYSTEMS 25 Norman D, Isidori AM, Frajese V, Caprio M, Chew SL, Grossman Sung HK, Chan YK, Han M, Jahng JWS, Song E, Danielson E, Berger AB, Clark AJ, Michael Besser G, Fabbri A. 2003. ACTH and α- T, Mak TW, Sweeney G. 2017. Lipocalin-2 (NGAL) attenuates MSH inhibit leptin expression and secretion in 3T3-L1 adipo- autophagy to exacerbate cardiac apoptosis induced by myo- cytes: model for a central–peripheral melanocortin-leptin cardial ischemia. J Cell Physiol. 232:2125–2134. pathway. Mol Cell Endocrinol. 200:99–109. Wu YT, Tan HL, Shui G, Bauvy C, Huang Q, Wenk MR, Ong CN, Penrose HM, Heller S, Cable C, Nakhoul H, Baddoo M, Codogno P, Shen HM. 2010. Dual role of 3-methyladenine Flemington E, Crawford SE, Savkovic SD. 2017. High-fat diet in modulation of autophagy via different temporal patterns induced leptin and Wnt expression: RNA-sequencing and of inhibition on class I and III phosphoinositide 3-kinase. J pathway analysis of mouse colonic tissue and tumors. Biol Chem. 285:10850–10861. Carcinogenesis. 38:302–311. Yoshizaki T, Kusunoki C, Kondo M, Yasuda M, Kume S, Morino K, Shehzad A, Iqbal W, Shehzad O, Lee YS. 2012. Adiponectin: Sekine O, Ugi S, Uzu T, Nishio Y, et al. 2012. Autophagy regu- regulation of its production and its role in human diseases. lates inflammation in adipocytes. Biochem Biophys Res Hormones. 11:8–20. Commun. 417:352–357. Skop V, Cahova M, Dankova H, Papackova Z, Palenickova E, Zhang C, He Y, Okutsu M, Ong LC, Jin Y, Zheng L, Chow P, Yu S, Svoboda P, Zidkova J, Kazdova L. 2014. Autophagy inhibition Zhang M, Yan Z. 2013. Autophagy is involved in adipogenic in early but not in later stages prevents 3T3-L1 differen- differentiation by repressesing proteasome-dependent tiation: effect on mitochondrial remodeling. Differentiation. PPARγ2 degradation. Am J Physiol Endocrinol Metab. 305: 87:220–229. E530–E539. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Animal Cells and Systems Taylor & Francis

Autophagy inhibition in 3T3-L1 adipocytes breaks the crosstalk with tumor cells by suppression of adipokine production

Animal Cells and Systems , Volume 24 (1): 9 – Jan 2, 2020

Autophagy inhibition in 3T3-L1 adipocytes breaks the crosstalk with tumor cells by suppression of adipokine production

Abstract

Several studies have revealed the functional importance of autophagy in both adipogenesis and carcinogenesis. Here, we investigated autophagy as a link between tumorigenesis and adipogenesis using 3T3-L1 cells, which have been shown to closely mimic the in vivo differentiation process. The relative levels of LC3-II/I showed that autophagy was the highest after 4–6 days of initiation of differentiation and it diminished thereafter. Furthermore, chloroquine (CQ), a late autophagy...
Loading next page...
 
/lp/taylor-francis/autophagy-inhibition-in-3t3-l1-adipocytes-breaks-the-crosstalk-with-VbEmC4dq80
Publisher
Taylor & Francis
Copyright
© 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group
ISSN
2151-2485
eISSN
1976-8354
DOI
10.1080/19768354.2019.1700159
Publisher site
See Article on Publisher Site

Abstract

MOLECULAR CELLULAR BIOLOGY ANIMAL CELLS AND SYSTEMS 2020, VOL. 24, NO. 1, 17–25 https://doi.org/10.1080/19768354.2019.1700159 Autophagy inhibition in 3T3-L1 adipocytes breaks the crosstalk with tumor cells by suppression of adipokine production Sung-Hee Hwang and Michael Lee Division of Life Sciences, College of Life Sciences and Bioengineering, Incheon National University, Incheon, Republic of Korea ABSTRACT ARTICLE HISTORY Received 26 July 2019 Several studies have revealed the functional importance of autophagy in both adipogenesis and Revised 31 October 2019 carcinogenesis. Here, we investigated autophagy as a link between tumorigenesis and Accepted 28 November 2019 adipogenesis using 3T3-L1 cells, which have been shown to closely mimic the in vivo differentiation process. The relative levels of LC3-II/I showed that autophagy was the highest KEYWORDS after 4–6 days of initiation of differentiation and it diminished thereafter. Furthermore, Adipocytes; adipokines; chloroquine (CQ), a late autophagy inhibitor, effectively inhibited adipogenic differentiation of autophagy; chloroquine; 3T3-L1 cells, suggesting that autophagy may have a positive impact on adipogenic tumors differentiation. Notably, real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis showed that CQ completely blocked the mRNA expression of three adipokines (adiponectin, leptin, and peroxisome proliferator-activated receptor-γ (PPARγ)), which increased proportionally to adipocyte differentiation. Using adipokine antibody arrays, we also found that among 38 adipokines examined, 6 adipokines were significantly differentially regulated in mature adipocytes compared to those in preadipocytes. A comparative analysis of adipokine production revealed that CQ-treated adipocytes displayed a profile similar to that of preadipocytes. Subsequently, CQ treatment significantly inhibited the migration capacity of v-Ha- ras-transformed cells in both 3T3-L1 adipocyte-conditioned medium and co-culture with 3T3-L1 using a transwell plate. Taken together, our results suggest that autophagy inhibition blocks the production of mediators relevant to the adipogenic process and may significantly contribute to reducing obesity-related cancer risk. Introduction adipocytes (Yoshizaki et al. 2012). Thus, the link between autophagy and cellular program of adipogen- Obesity is increasing worldwide and is a well-known risk esis remains to be further defined. factor for several cancers (De Pergola and Silvestris 2013). Besides its contrasting role in adipocyte differen- However, its underlying mechanism is not yet well tiation, autophagy also has opposing, context-depen- understood. Adipose-secreted adipokines might be one dent roles in cancer (Levy et al. 2017). Autophagy has of the underlying factors that have been suggested to been known to function as a tumor suppressor by explain the association between obesity and increased removing damaged organelles/proteins and limiting risk of certain cancers (Gui et al. 2017). Moreover, a pre- cell growth (Mathew et al. 2009). In contrast, other evi- vious study demonstrated that adipokines from mature dence indicates that the predominant role of autophagy adipocytes exhibited the ability to promote cell growth, in cancer cells is to maintain tumor cell survival (Degen- motility, and invasion of breast cancer cells in vitro hardt et al. 2006). Our previous studies also showed that (Iyengar et al. 2003). autophagy could play a dual role in either pro-cell survi- It has been reported that autophagy is critical for lipid val or pro-cell death in response to anticancer drugs accumulation and adipocyte differentiation factors (Hwang et al. 2018). (Jansen et al. 2012). Genetic disruption of autophagy- In this study, we investigated autophagy as a link related genes significantly impedes adipogenesis in cul- between tumorigenicity and adipocyte differentiation. tured preadipocytes and in mice (Baerga et al. 2009). On The 3T3-L1 cell line, which is used extensively as an in the other hand, there is a contrasting report that autop- vitro model to generate adipocyte-like cells, was used hagy is downregulated in the adipose tissue derived as the adipocyte differentiation model. Our study from high fat-fed mice and in hypertrophic 3T3-L1 CONTACT Michael Lee mikelee@inu.ac.kr Division of Life Sciences, College of Life Sciences and Bioengineering, Incheon National University, Incheon 22012, Republic of Korea © 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 18 S.-H. HWANG AND M. LEE revealed that autophagy is specifically required for the 510 nm using a SpectraMax 190 Microplate Reader (Mol- initial stage of adipogenic differentiation. Furthermore, ecular Devices, Sunnyvale, CA, USA). our results suggested that autophagy might regulate adi- pogenesis and carcinogenesis via crosstalk with adipo- Autophagy monitoring assay by conversion of kines secreted by adipocytes. Thus, the results of our LC3 report could contribute to the development of auxiliary therapy against obesity-related cancer risk. Autophagy was measured by the conversion of LC3-I to LC3-II by immunoblot analysis as previously (Hwang et al. 2018). Detection was achieved using the Bio-Rad Materials and methods ChemiDoc XRS+ instrument (Hercules, CA, USA), and Reagents and antibodies the data were visualized using the Bio-Rad Image Lab software version 5.2.1 (Bio-Rad Laboratories). Proteome Profiler Mouse Adipokine Array Kit (Catalog # ARY013) was purchased from R&D Systems (Minneapolis, MN, USA). Dulbecco’s modified Eagle’s medium (DMEM), Cell viability assay and fetal bovine serum (FBS) were purchased from The cells were seeded in quadruplicate in 96-well micro- Thermo Fisher Scientific (Carlsbad, CA, USA). Insulin, 3- titer plates (Costar, Cambridge, MA, USA) at a density of isobutyl-1-methylxanthine (IBMX), dexamethasone 5×10 cells/well and then incubated at 37°C in a (DEX), Oil Red O dye, and chloroquine (CQ) were pur- humidified 5% CO /95% air incubator. On the indicated chased from Sigma–Aldrich (St. Louis, MO, USA). days, the cells were incubated with WST-1 reagent at 37°C for 3 h. The absorbance of the samples against a background control (medium alone), which served as a Cell lines and culture conditions blank, was measured at 450 nm using a SpectraMax Murine preadipocyte (3T3-L1) cells were purchased from 190 microplate reader. the American Type Culture Collection (Manassas, VA, USA). 3T3-L1 preadipocytes were cultured in DMEM- F12 supplemented with 10% FBS and kept at 37°C in a Real-time quantitative reverse transcription-PCR 5% CO incubator. The 3T3-L1 cells used for all following 2 (qPCR) analysis investigations were of low passage number and were Total RNA isolation, reverse transcription, and PCR reac- routinely subdivided at <70% confluence. The v-Ha-ras- tion were performed as described previously (Kim et al. transformed NIH3T3 (Ras-NIH3T3) cells were maintained 2017). All primers were synthesized by Bioneer at 37°C in DMEM supplemented with 10% FBS. (Daejeon, Korea). The primer sequences used for the qPCR analysis are listed in Table 1. The real-time PCR data were normalized for differences in β-actin levels Differentiation of 3T3-L1 cells and oil red O −ΔΔCt by analysis with the 2 method. staining For adipocyte differentiation, 3T3-L1 preadipocytes were seeded in 48-well culture plates (1.5 × 10 cells/well) and Proteome Profiler™ adipokine array analysis grown to confluence. Differentiation of 2-day post- Proteome Profiler Mouse Adipokine Array Kits were used confluent preadipocytes (designated as day 0) was to simultaneously detect the relative expression levels of initiated with medium containing MDI (10 μg/mL 38 adipokines using protein lysates from 3T3-L1 adipo- insulin, 1 μM DEX, and 0.5 mM IBMX) in DMEM-F12 cytes. The array was performed according to the manu- with 10% FBS. Three days later, the medium was facturer’s instructions. Briefly, protein (250 μg) was replaced with DMEM-F12 containing 10% FBS and incubated overnight with the adipokine antibody cock- 10 μg/mL insulin. Another 2 days later, the medium tail. The antigen–antibody reaction was detected by che- was changed to DMEM-F12 + 10% FBS. Differentiated miluminescent detection substrate (Thermo Fisher cells were used for functional assays on days 8–9 after Scientific, Rockford, IL, USA) and images were captured differentiation was initiated. In vitro, differentiated cells were fixed for 20 min in buffered formalin and stained Table 1. Primer sequence for real-time quantitative PCR analysis. with Oil Red O for 3 h. For the quantification of lipid dro- ′ ′ ′ ′ Genes Forward primer (5 -3 ) Reverse primer (5 -3 ) plets, stained cells were dried completely and extracted Adiponectin GTGCAGGTTGGATGGCAGGCA CAGTGACGCGGGTCTCCAGC with isopropanol (0.5 mL/well of a 24-well plate). The Leptin CCCTGTGGAGGTGAGCGGGA CCAGCCACCACGAGCCTTCG PPARγ GCCTTCGCTGATGCACTGCC CAGCAACCATTGGGTCAGCTCT optical density of the extracted dye was measured at ANIMAL CELLS AND SYSTEMS 19 by a Molecular imager (Bio-Rad). Densitometric analysis In vitro cell migration assay of immunoreactions on the captured image was per- An in vitro cell migration assay was carried out using a formed by Image Lab software version 5.2.1 (Bio-Rad). 24-well transwell culture system as described pre- viously (Hwang et al. 2018). For quantitation, the crystal violet dye retained on the filters was acid Culture of Ras-NIH3T3 cells in adipocyte- extracted, and cell migration was measured by conditioned medium reading the absorbance at 550 nm. Each experiment was performed in triplicate. When 3T3-L1 adipocytes were differentiated to day 12 in the absence and presence of CQ, the medium was replaced with 1% FBS/DMEM for 24 h. The supernatants Results were collected and used as an adipocyte-conditioned medium (Ad-CM) for subsequent in vitro studies. To The role of autophagy in 3T3-L1 adipocyte test the effect of Ad-CM on the growth of Ras-NIH3T3 differentiation cells, different concentrations of Ad-CM were prepared Differentiation of 3T3-L1 preadipocytes into adipocytes in a fresh 1% FBS/DMEM medium. was monitored by staining with the neutral lipid- specific dye Oil Red O, which reveals the formation of visible lipid droplets. As shown in Figure 1A, 3T3-L1 Co-culture of Ras-NIH 3T3cells with 3T3-L1 cells treated with MDI readily differentiated into morpho- adipocytes logically distinct fat-laden adipocytes. To reveal the role To mimic the physiological environment of the obesity- of autophagy during differentiation of 3T3-L1 preadipo- related tumor, Ras-NIH3T3 cells and 3T3-L1 adipocytes cytes, we measured LC3-I to LC3-II conversion, which is were co-cultured using a transwell culture system a good indicator of autophagy. The relative levels of (0.4 mm pore size). Firstly, 3T3-L1 cells were seeded in LC3-II/I showed that autophagy reached a maximum 6-well plates and differentiated into adipocytes in the after 4–6 days of initiation of differentiation and dimin- absence and presence of CQ until day 12. Ras-NIH3T3 ished thereafter (Figure 1B). In addition, treatment with cells were seeded in the upper chamber of a 6-well trans- CQ, which is known to inhibit the fusion of autophago- well culture system at a density of 4.25 × 10 cells/well some with lysosome (Kimura et al. 2013), impaired differ- and co-cultivated with or without mature adipocytes in entiation of 3T3-L1 cells (Figure 2A and B). These data the lower chamber. Ras-NIH3T3 cells cultivated alone in collectively suggest that autophagy may have a positive similar conditions served as controls. impact on adipogenic differentiation. Figure 1. Autophagy induction during adipocyte differentiation of 3T3-L1 preadipocytes. (A) Morphological evidence of adipocyte differ- entiation at day 9 of the conversion process was monitored by the appearance of fat droplets utilizing light microscopy after oil red O staining. (B) At −3, 0, 2, 4, 6, 8 and 10 days after initiation of differentiation, the change in the electrophoretic mobility of LC3 from a non-autophagic (LC3-I) form to an autophagic membrane-recruited (LC3-II) form was determined by immunoblotting. β-Actin expression was assessed as protein loading control. The presented results are representative of at least three independent experiments. 20 S.-H. HWANG AND M. LEE Figure 2. The effect of the late-stage autophagy inhibitor chloroquine on 3T3-L1 adipocyte differentiation. The 3T3-L1 preadipocytes were treated with 10 μMCQindifferentiation medium for 3 days before being switched to insulin medium. (A) A representative image of Oil Red O staining of cells at day 9. (B) Left, A representative image of a 6-well plates stained with Oil Red O at day 9; Right, Quantifi- cation of Oil Red O staining (n = 3/treatment). Late-stage autophagy inhibitor chloroquine In addition, Proteome Profiler mouse adipokine anti- affects the production of adipokines body arrays were performed to identify the differentially expressed adipokines in differentiated adipocytes. Adipokines secreted by the adipose tissue play an important Figure 4A depicts images of chemiluminescent reaction role in adipocyte differentiation (Hauner 2005). Thus, we spots that represent the expression of 38 adipokines in investigated whether autophagy is also closely linked to 3T3-L1 cells. Among 38 adipokines examined, we found adipokine production. Among the adipokines, leptin, adipo- 6 adipokines (adiponectin, lipocalin-2, resistin, VEGF, nectin, and PPARγ arecurrently themostprominent dueto leptin, and serpin E1/PAI-1) that were significantly differ- their functions in the regulation of adipogenesis (Deng and entially regulated in mature adipocytes compared to Scherer 2010). The qPCR assay revealed that the expressions those in preadipocytes (Figure 4B). CQ-treated adipo- of three adipokine mRNA were first detected on day 3 of cytes displayed a profile similar to that of preadipocytes, initiation of differentiation and then increased progressively with a significant reduction of adiponectin, lipocalin-2, as the cells acquired a terminally differentiated phenotype resistin, and VEGF expression, but only a minor effect (Figure 3). Notably, CQ completely blocked the increase of on leptin. Interestingly, serpin E1/PAI-1 was downregu- mRNA expression of these adipokines in 3T3-L1 cells lated in differentiated cells but recovered to its normal during MDI-induced adipocyte differentiation. level after CQ treatment. These observations suggest ANIMAL CELLS AND SYSTEMS 21 Figure 3. The effect of chloroquine on adipokine mRNA expression during 3T3-L1 adipocyte differentiation. Total RNA was isolated from 3T3-L1 cells at 1, 3, 4, 7, 11, and 14 days after initiation of differentiation in the presence or absence of 10 μM CQ. The mRNA levels of three adipokines (adiponectin, leptin, and PPARγ) were measured by real-time qRT-PCR. For quantitative analysis of gene −ΔΔCt expression, the comparative threshold cycle (Ct) method for relative quantification (2 ) was used. The expression of the target genes was normalized to β-actin expression. Values represent the mean ± standard deviation (SD) of quadruplicate determinants from one of three representative experiments. **p < .01 compared to preadipocytes, as determined by Dunnett’s test. that autophagy modulates several key factors of adipo- was significantly increased by 39% (p < 0.01) (Figure genic differentiation. 5C). The migration capacity was somewhat greater in Ras-NIH3T3 cells co-cultivated with mature adipocytes, although it was statistically insignificant (Figure 5D). Chloroquine breaks the crosstalk between Ras- However, the migration capacity of Ras-NIH3T3 cells NIH3T3 cells and adipocytes was greatly suppressed when co-cultivated with 3T3- Adipokines secreted from mature adipocytes might be L1 cells treated with CQ. These results suggest that one of the factors that have been suggested to impaired autophagy deregulates the production of adi- explain the association between obesity and increased pokines relevant to the adipogenic process, and may risk of certain cancers (Gui et al. 2017). Thus, we evalu- significantly contribute to the migration capacity of ated the effect of Ad-CM on Ras-NIH3T3 cells, which tumor cells. clearly show morphologically transformed foci of cells. Ras-NIH3T3 cells were cultured for 48 h in 1%, 5%, Discussion 10%, and 50% Ad-CM in fresh complete medium. Ad- CM exerted no effect on the viability of Ras-NIH3T3 Autophagy may play a crucial role in modulating adipo- cells, regardless of CQ treatment, as compared to cells genic differentiation (Jansen et al. 2012), provoking a cultured in normal media (Figure 5A). However, cell considerable interest in the possibility of targeting migration assay showed that CQ-treated Ad-CM autophagy for the prevention and treatment of greatly abrogated the migration capacity of Ras- obesity-related diseases. In this study, we found that NIH3T3 cells (Figure 5B). Next, to mimic the physiologi- the relative levels of LC3-II/I were increased most signifi- cal environment of obesity-related cancer, Ras-NIH3T3 cantly on days 4–6 after initiation of adipogenic differen- cells were co-cultured using a transwell culture tiation and then returned to normal levels thereafter. system with differentiated 3T3-L1 cells. After co-cultiva- Consistent with our results, it has been reported that tion with 3T3-L1 cells, the viability of Ras-NIH3T3 cells autophagy is essential and most active during the 22 S.-H. HWANG AND M. LEE Figure 4. Chloroquine modulates adipokine production in 3T3-L1 adipocytes. 3T3-L1 preadipocytes were differentiated to day 7 into mature adipocytes in the presence or absence of 10 μM CQ. The cell lysates from preadipocytes and mature adipocytes were assessed for adipokine expression using an antibody adipokine array. In (A), images of chemiluminescent reaction spots on adipokine profiler membranes representing the expression of various adipokines in 3T3-L1 cells differentiated in the presence and absence of 30 μM of CQ. In (B), a comparative expression of adipokines (in arbitrary units) obtained from densitometric analysis of the chemiluminescent reaction spots is tabulated. initial stage of adipocyte differentiation, but it is dispen- LAP) has been reported to promote early adipogenic sable during the later stages (Skop et al. 2014). We used differentiation by directly activating expression of CQ, which is currently the most widely used autophagy PPARγ2 (Lechner et al. 2013). Several studies have used inhibitor, to block autophagy in 3T3-L1 preadipocytes. RNA-Seq analysis to investigate the genes related to adi- In particular, CQ is the only clinically available autophagy pogenesis, some of which have been associated with inhibitors approved by the US Food and Drug Adminis- tumorigenesis. The RNA-Seq study by Mangiola et al. tration (Mauthe et al. 2018). Although the type III PI3K (2018) suggests that periprostatic adipose tissue from inhibitor 3-MA was the first identified inhibitor of autop- patients with high-risk prostate cancer has a distinct tran- hagy, a recent study presents a finding that 3-MA could scriptional signature, which was confirmed by qPCR in an promote autophagy under nutrient-rich conditions for a expanded cohort. In particular, Leptin and Wnt have prolonged period (Wu et al. 2010). Our results revealed been demonstrated as the top two transcripts elevated that, when treated with CQ, 3T3-L1 cells exhibited drasti- in mouse high fat diet colon shared with tumors, using cally reduced the efficiency of adipocyte differentiation. next generation RNA sequencing and pathway analysis These data collectively suggest that autophagy may (Penrose et al. 2017). have a positive impact on adipogenic differentiation. Adipokines secreted from mature adipocytes might be However, the precise mechanisms by which autophagy one of the factors that have been suggested to explain induces adipogenic differentiation are poorly under- the association between obesity and increased risk of stood. An intriguing hypothesis is that autophagy certain cancers (Gui et al. 2017). Here, we evaluated increases the stability of PPARγ2, the key regulator of adi- the role of autophagy in the expression of three adipo- pogenesis (Zhang et al. 2013). In addition, the full-length kines (adiponectin, leptin, and PPARγ), which are cur- isoform of CCAAT enhancer binding protein β (C/EBPβ- rently the most prominent due to their functions in ANIMAL CELLS AND SYSTEMS 23 Figure 5. Chloroquine breaks the crosstalk between Ras-NIH 3T3 cells and adipocytes. (A and B) Ad-CM was collected from 3T3-L1 adipocytes that were differentiated to day 12 in the absence and presence of CQ. In (A), Ras-NIH 3T3 cells were cultured in the presence of increasing concentrations of Ad-CM for 48 h. Cell viability was then evaluated using WST-1 reagent. The values represent mean ± SD of quadruplicates from one of three representative experiments. In (B), Ras-NIH 3T3 cells were incubated for 4 h in 10% Ad-CM, and then migration was measured in vitro using transwell system. One representative data were presented. n =3; *p < .05 compared to cells cultured in normal Ad-CM. (C and D) Ras-NIH 3T3 cells were co-cultured with adipocytes that were differentiated in the presence or absence of CQ for 48 h using a transwell system. In (C), Ras-NIH 3T3 cells were trypsinized and cell viability was evaluated using WST-1 reagent. The values represent mean ± SD of quadruplicates from one of three representative experiments. In (D), the migration capacity of Ras-NIH 3T3 cells was measured in vitro using transwell system. One representative data were presented. n =3; **p < .01 and *p < .05 compared to cells grown alone. the regulation of adipogenesis (Deng and Scherer 2010). increased in 3T3-L1 adipocytes, although it has been The real-time qRT-PCR analysis showed that the reported that adiponectin characteristically differs from expression of these three adipokines increased propor- most adipokines as it is negatively correlated with tionally to adipocyte differentiation. In addition, adipo- obesity (Shehzad et al. 2012). However, unlike the kine antibody array showed that among 38 adipokines results obtained in qRT-PCR analysis, no significant examined, 5 adipokines were upregulated during differ- increase in leptin level was observed in adipokine anti- entiation of 3T3-L1 preadipocytes into adipocytes, with body arrays. Norman et al. (2003) reported that differen- a time-course comparable to that of other adipocyte tiated 3T3-L1 adipocytes express only small amounts of markers. These five adipokines included adiponectin, leptin. Interestingly, we observed that serpin E1/PAI, lipocalin-2, resistin, leptin, and VEGF. In particular, lipo- which has well-documented pro-tumorigenic functions calin-2 and resistin levels were most dramatically (Fang et al. 2012), was downregulated in differentiated increased in parallel with adipocyte differentiation. 3T3-L1 adipocytes. Our findings are consistent with Recently, it has been reported that resistin is upregu- those of Liang et al. (2006), in which serpin E1/PAI-1 lated in patients with breast cancer and promotes deficiency promoted adipocyte differentiation. As breast cancer cell growth, invasion, and migration (Lee expected, CQ-treated cells displayed an adipokine et al. 2016). Lipocalin-2 (NGAL) was found to attenuate profile similar to that of preadipocytes. Five upregulated autophagy to exacerbate cardiac apoptosis induced by adipokines returned to their original levels when treated myocardial ischemia (Sung et al. 2017). Unexpectedly, with CQ. The serpin E1/PAI-1 also returned to its original we found that adiponectin expression was significantly level when treated with CQ. 24 S.-H. HWANG AND M. LEE promotes tumor cell survival and restricts necrosis, inflam- Subsequently, the culture of Ras-NIH3T3 cells in 3T3- mation, and tumorigenesis. Cancer Cell. 10:51–64. L1 Ad-CM and co-culture of 3T3-L1 and Ras-NIH3T3 Deng Y, Scherer PE. 2010. Adipokines as novel biomarkers and cells using a transwell plate were performed to clarify regulators of the metabolic syndrome. Ann N Y Acad Sci. the relationship between adipocytes and tumor cells. 1212:E1–E19. Ad-CM exerted no effect on both the proliferative De Pergola G, Silvestris F. 2013. Obesity as a major risk factor for ability and migration capacity of Ras-NIH3T3 cells. cancer. J Obes. 2013. 291546. Fang H, Placencio VR, DeClerck YA. 2012. Protumorigenic However, our co-culture system showed that Ras- activity of plasminogen activator inhibitor-1 through an anti- NIH3T3 cells co-cultivated with mature 3T3-L1 adipo- apoptotic function. J Natl Cancer Inst. 104:1470–1484. cytes exhibited enhanced migration, suggesting that Gui Y, Pan Q, Chen X, Xu S, Luo X, Chen L. 2017. The association mature adipocytes are able to stimulate the migration between obesity related adipokines and risk of breast cancer: capacities of cancer cell lines. Co-culture with adipocytes a meta-analysis. Oncotarget. 8:75389–75399. Hauner H. 2005. Secretory factors from human adipose tissue also has an enhancing effect on Ras-NIH3T3 cell prolifer- and their functional role. Proc Nutr Soc. 64:163–169. ation. Conversely, CQ treatment significantly inhibited Hwang S-H, Han B-I, Lee M. 2018. Knockout of ATG5 leads to the migration capacity of Ras-NIH3T3 cells in both the malignant cell transformation and resistance to Src family Ad-CM model and the co-culture system. In particular, kinase inhibitor PP2. J Cell Physiol. 233:506–515. these results suggest that the deregulation of adipokine Iyengar P, Combs TP, Shah SJ, Gouon-Evans V, Pollard JW, levels in adipocytes after CQ treatment might contribute Albanese C, Flanagan L, Tenniswood MP, Guha C, Lisanti MP, et al. 2003. Adipocyte-secreted factors synergistically to the suppressed migration capacity of tumor cells. This promote mammary tumorigenesis through induction of may probably be due to the difference of expression anti-apoptotic transcriptional programs and proto-oncogene ratio relative to each of the other adipokines, rather stabilization. Oncogene. 22:6408–6423. than of the absolute expression level of each adipokine Jansen HJ, van Essen P, Koenen T, Joosten LA, Netea MG, Tack between control and CQ-treated adipocytes. CJ, Stienstra R. 2012. Autophagy activity is up-regulated in adipose tissue of obese individuals and modulates proi- Taken together, our results revealed that autophagy is nflammatory cytokine expression. Endocrinology. essential and most active during the initial stage of adi- 153:5866–5874. pocyte differentiation, but it is dispensable during the Kim JH, Ahn JH, Lee M. 2017. Upregulation of MicroRNA-1246 is later stages. More importantly, CQ treatment blocked associated with BRAF inhibitor resistance in Melanoma cells the production of mediators relevant to the adipogenic with Mutant BRAF. Cancer Res Treat. 49:947–959. process in the co-culture system, and might significantly Kimura T, Takabatake Y, Takahashi A, Isaka Y. 2013. Chloroquine in cancer therapy: a double-edged sword of autophagy. contribute to the suppression of obesity-related cancer Cancer Res. 73:3–7. development. These results suggest that CQ broke the Lechner S, Mitterberger MC, Mattesich M, Zwerschke W. 2013. crosstalk between these two cell lines, possibly contri- Role of C/EBPβ-LAP and C/EBPβ-LIP in early adipogenic differ- buting to its chemopreventive properties in cancer. entiation of human white adipose-derived progenitors and at Thus, in future studies on the effects of obesity and sub- later stages in immature adipocytes. Differentiation. 85:20–31. Lee JO, Kim N, Lee HJ, Lee YW, Kim SJ, Park SH, Kim HS. 2016. sequent alterations in adipokine expression in tumor Resistin, a fat-derived secretory factor, promotes metastasis cells, it is important to verify the role of autophagy as a of MDA-MB-231 human breast cancer cells through ERM acti- potential therapeutic target. vation. Sci Rep. 6:18923. Levy JMM, Towers CG, Thorburn A. 2017. Targeting autophagy in cancer. Nat Rev Cancer. 17:528–542. Disclosure statement Liang X, Kanjanabuch T, Mao SL, Hao CM, Tang YW, Declerck PJ, Hasty AH, Wasserman DH, Fogo AB, Ma LJ. 2006. Plasminogen No potential conflict of interest was reported by the authors. activator inhibitor-1 modulates adipocyte differentiation. Am J Physiol Endocrinol Metab. 290:E103–E113. Mangiola S, Stuchbery R, Macintyre G, Clarkson MJ, Peters JS, Funding Costello AJ, Hovens CM, Corcoran NM. 2018. Periprostatic fat tissue transcriptome reveals a signature This research was supported by the Incheon National University diagnostic for high-risk prostate cancer. Endocr Relat Research Grant in 2018. Cancer. 25:569–581. Mathew R, Karp CM, Beaudoin B, Vuong N, Chen G, Chen HY, Bray K, Reddy A, Bhanot G, Gelinas C, et al. 2009. References Autophagy suppresses tumorigenesis through elimination of p62. Cell. 137:1062–1075. Baerga R, Zhang Y, Chen PH, Goldman S, Jin S. 2009. Targeted Mauthe M, Orhon I, Rocchi C, Zhou X, Luhr M, Hijlkema KJ, deletion of autophagy-related 5 (atg5) impairs adipogenesis Coppes RP, Engedal N, Mari M, Reggiori F. 2018. in a cellular model and in mice. Autophagy. 5:1118–1130. Chloroquine inhibits autophagic flux by decreasing autopha- Degenhardt K, Mathew R, Beaudoin B, Bray K, Anderson D, Chen gosome-lysosome fusion. Autophagy. 14:1435–1455. G, Mukherjee C, Shi Y, Gélinas C, Fan Y, et al. 2006. Autophagy ANIMAL CELLS AND SYSTEMS 25 Norman D, Isidori AM, Frajese V, Caprio M, Chew SL, Grossman Sung HK, Chan YK, Han M, Jahng JWS, Song E, Danielson E, Berger AB, Clark AJ, Michael Besser G, Fabbri A. 2003. ACTH and α- T, Mak TW, Sweeney G. 2017. Lipocalin-2 (NGAL) attenuates MSH inhibit leptin expression and secretion in 3T3-L1 adipo- autophagy to exacerbate cardiac apoptosis induced by myo- cytes: model for a central–peripheral melanocortin-leptin cardial ischemia. J Cell Physiol. 232:2125–2134. pathway. Mol Cell Endocrinol. 200:99–109. Wu YT, Tan HL, Shui G, Bauvy C, Huang Q, Wenk MR, Ong CN, Penrose HM, Heller S, Cable C, Nakhoul H, Baddoo M, Codogno P, Shen HM. 2010. Dual role of 3-methyladenine Flemington E, Crawford SE, Savkovic SD. 2017. High-fat diet in modulation of autophagy via different temporal patterns induced leptin and Wnt expression: RNA-sequencing and of inhibition on class I and III phosphoinositide 3-kinase. J pathway analysis of mouse colonic tissue and tumors. Biol Chem. 285:10850–10861. Carcinogenesis. 38:302–311. Yoshizaki T, Kusunoki C, Kondo M, Yasuda M, Kume S, Morino K, Shehzad A, Iqbal W, Shehzad O, Lee YS. 2012. Adiponectin: Sekine O, Ugi S, Uzu T, Nishio Y, et al. 2012. Autophagy regu- regulation of its production and its role in human diseases. lates inflammation in adipocytes. Biochem Biophys Res Hormones. 11:8–20. Commun. 417:352–357. Skop V, Cahova M, Dankova H, Papackova Z, Palenickova E, Zhang C, He Y, Okutsu M, Ong LC, Jin Y, Zheng L, Chow P, Yu S, Svoboda P, Zidkova J, Kazdova L. 2014. Autophagy inhibition Zhang M, Yan Z. 2013. Autophagy is involved in adipogenic in early but not in later stages prevents 3T3-L1 differen- differentiation by repressesing proteasome-dependent tiation: effect on mitochondrial remodeling. Differentiation. PPARγ2 degradation. Am J Physiol Endocrinol Metab. 305: 87:220–229. E530–E539.

Journal

Animal Cells and SystemsTaylor & Francis

Published: Jan 2, 2020

Keywords: Adipocytes; adipokines; autophagy; chloroquine; tumors

References