DeepDyve requires Javascript to function. Please enable Javascript on your browser to continue.
Differentiation potential of mesenchymal stem cells isolated from human dental tissues into non-mesodermal lineage Differentiation potential of mesenchymal stem cells isolated from human dental tissues into...
Jeon, Byeong-Gyun; Jang, Si-Jeong; Park, Ji-Seong; Subbarao, Raghavendra Baregundi; Jeong, Gie-Joon; Park, Bong-Wook; Rho, Gyu-Jin
2015-09-03 00:00:00
DEVELOPMENTAL BIOLOGY Animal Cells and Systems, 2015 Vol. 19, No. 5, 321–331, http://dx.doi.org/10.1080/19768354.2015.1087430 Differentiation potential of mesenchymal stem cells isolated from human dental tissues into non- mesodermal lineage a,d b b b a Byeong-Gyun Jeon , Si-Jeong Jang , Ji-Seong Park , Raghavendra Baregundi Subbarao , Gie-Joon Jeong , Bong- c b Wook Park and Gyu-Jin Rho * Department of Biology Education, College of Education, Gyeongsang National University, Jinjudaero 501, Jinju 660-701, Republic of Korea; OBS/Theriogenology and Biotechnology, College of Veterinary Medicine, Gyeongsang National University, Jinjudaero 501, Jinju 660-701, Republic of Korea; Department of Oral and Maxillofacial Surgery, School of Medicine and Institute of Health Science, Gyeongsang National University, Jinjudaero 501, Jinju 660-701, Republic of Korea; Research Institute of Education, Gyeongsang National University, Jinjudaero 501, Jinju 660-701, Republic of Korea (Received 1 July 2015; received in revised form 21 August 2015; accepted 24 August 2015) Mesenchymal stem cells (MSCs) possess the ability to differentiate into non-mesodermal lineage, and examining their multi- potency will be beneficial for application in regenerative medicine. The present study investigated the differentiation capacity into neuronal cells of ectodermal lineage and pancreatic cells of endodermal lineage in each of MSC lines isolated from three samples of human dental papilla tissues (DPSCs). Isolated DPSC lines expressed CD13, CD44, CD73, CD90 and CD105 cell surface markers, and OCT-4, NANOG and SOX-2 transcription factors. Further, all DPSC lines differentiated into osteocytes, adipocytes and chondrocytes of mesodermal lineage, whereas telomerase activity was at a low level in all isolated DPSC lines. Following induction into neuronal cells of ectodermal lineage, the neuron-like morphological alterations and expression of neuro-filament M by immunocytochemical staining was observed in all types of DPSCs, and expression of neuronal cell-specific transcripts, NSE, MAP-2, and NESTIN was further confirmed by reverse transcription-polymerase chain reaction (RT-PCR). Moreover, following induction into pancreatic cells of endodermal lineage, all DPSC lines exhibited morphological alterations with DTZ-positive spheroid clusters, and expression of pancreatic cell-specific transcripts, INSULIN, PDX-1, and GLUT-2, was positively detected by RT-PCR. However, some of these clusters were negatively reacted with DTZ staining. The present results demonstrated that DPSCs exhibit differentiation capacity into neuronal and pancreatic cells of non-mesodermal lineage, and DPSCs could be an alternative source of MSCs for clinical applications. Keywords: human; dental mesenchymal stem cells; differentiation; endodermal lineage; ectodermal lineage Introduction dental tissues with the developing third molar (wisdom tooth) bud are a unique source of MSCs (Jeon et al. Mesenchymal stem or stromal cells (MSCs) are a kind of 2011a, 2011b; Patil et al. 2014). In our previous studies, adult stem cells preferentially found in the bone marrow. MSCs derived from dental papilla tissue (DPSCs) of In addition to MSCs isolated from the bone marrow, third molars showed outstanding cellular properties, telo- many groups have isolated MSCs from various tissues merase activity, length of telomeric repeats, reverse tran- and organs of the body, which exists there, for regenerating scriptase activity, cluster of differentiation (CD) surface damaged tissues. Till recently, human-derived MSCs were markers and expression of transcripts, compared to those isolated from diverse tissues such as adipose, skin, umbili- of bone marrow MSCs, adipose MSCs and dental pulp/ cal cord matrix, dental pulp/papilla and others have fully follicle MSCs (Jeon et al. 2011a, 2011b). demonstrated the cellular properties of MSCs for clinical It has been suggested by other studies that the most and research applications (Jeon et al. 2011a, 2011b; important cellular properties to define MSCs isolated Akiyama et al. 2012; Karaoz et al. 2013). The various from various tissues is the capacity of self-renewal and types of MSCs exhibited similar fibroblasts-like mor- differentiation into specific cell types and tissues phology and growth pattern following attachment onto (Chambers et al. 2003; Dominici et al. 2006; Huang et al. plastic culture plates (Jeon et al. 2011a, 2011b). The inves- 2015). Even though maintenance of self-renewal capacity tigated MSCs also expressed the fundamental cellular in various types of MSCs remains open to question, their properties of alkaline phosphatase activity, stem-cell- cellular properties on differentiation capacity have been specific cell surface makers and pluripotent stem-cell- well demonstrated. Each of the MSCs derived from specific transcripts, such as SOX-2, OCT-4 and NANOG various types of tissues was induced into cell types of (Song et al. 2011; Lee et al. 2013; Patil et al. 2014). mesodermal lineage, such as bone, cartilage, fat, muscle, Further, it has been demonstrated that cells derived from *Corresponding author. Email: jinrho@gnu.ac.kr © 2015 Korean Society for Integrative Biology 322 B.-G. Jeon et al. tendon, marrow stroma and others (Jeon et al. 2011a, specified. The pH and osmolality of the media were 2011b; Song et al. 2011; Lee et al. 2011). Due to the cellu- adjusted to 7.4 and 280 mOsm/kg, respectively. MRC-5 lar features exhibited by MSCs, these cells have been normal human fetal lung fibroblasts (ATCC, USA) were successfully applied in many areas, such as clinical and used as somatic cell controls. DPSC lines were isolated research applications, including cell therapy in field of from papilla tissues of the extracted teeth of three regenerative medicine, cell-based screening test for medi- donors, as described previously (Jeon et al. 2011b). In cation development, to study differentiation and gene brief, growing, but not erupted human third molars regulation (Sensebe et al. 2010; Wang et al. 2011). were surgically extracted from each of three female Further, recent studies have demonstrated that human patients (16–18 years of age) as a part of prophylactic MSCs exhibit immunomodulatory properties and immuno- treatment for orthodontic reasons at the Dental Clinic of suppressive effects in vitro and in vivo observed results; Gyeongsang National University Hospital under approved these properties of MSCs are indispensable for safe medical guidelines set by the GNUH IRB-2009-34 and transplantable cell source for cell therapy in the field of after obtaining the informed consents from the patients. regenerative medicine and tissue engineering without The extracted teeth were rinsed several times in Dulbec- inflammatory property (Nauta & Fibbe 2007). co’s phosphate buffered saline (D-PBS) containing 1% In our previous studies, each of the MSCs derived from Pen-Strep and brought to the laboratory in iced D-PBS. dental papilla, pulp and follicle tissues has been success- Dental papilla tissues were gently obtained from the fully differentiated into cell types of mesodermal lineage, apical part of the extracted tooth and immediately such as adipocytes, chondrocytes and osteocytes with minced with sterilized scalpel. The small masses of the outstanding cellular properties, compared to other MSCs dental papilla tissues were isolated into single cells by (Jeon et al. 2011a, 2011b). It was also reported that treating with D-PBS containing 1 mg/ml collagenase dental MSCs can easily differentiate into mesoderm-origi- type I at 37°C with gentle agitation for 30 min. After nated mesenchyme cell type under in vitro conditions being washed with D-PBS, the single cells were har- (Cheng et al. 2008; Patil et al. 2014). Moreover, recent vested through a 100-μm nylon cell strainer. The isolated studies have increasingly demonstrated that several types cells were cultured in an Advanced Dulbecco’s Modified of MSCs derived from bone marrow, skin and umbilical Eagle Medium (A-DMEM) supplemented with 10% fetal cord matrix are trans-differentiated into neuronal cells, bovine serum (FBS), 1.0% Pen-Strep at 37.5°C in a cardiomyocytes, hepatocytes or epithelial cells of non- humidified atmosphere of 5% CO in air and culture mesodermal lineage, such as endodermal and ectodermal medium was changed twice a week. DPSC lines at lineage (Yan et al. 2007; Kumar et al. 2012; Patil et al. passage 3 were used for further experiment and analysis. 2014; Du et al. 2015; Gervois et al. 2015). However, the differentiation capacity into cell types of non-mesodermal Cell surface marker profile by flow cytometry lineage has not been fully investigated in MSCs derived from dental tissues. The expression of stem-cell-specific surface markers were To further evaluate the differentiation potential, in the analyzed using fluorescence-activated cell sorting with a present study, MSC (DPSC) lines were isolated from flow cytometer in each of isolated DPSC lines, before con- human dental papilla tissues of three donors and sub- ducting further experiments. The cell surface markers used sequently investigated on the cellular characterizations of were CD13, CD44, CD73, CD90 and CD105 as positive MSCs, including expression of the CD surface markers, MSC markers, and CD34 and CD45 as negative MSC pluripotent transcripts and telomerase activity, and differ- markers, respectively. Briefly, the cultured DPSC lines at entiation capacity into cell types of mesodermal lineage. passage 3 were harvested by treating with 0.25% (w/v) Further, we investigated differentiation possibility into trypsin-ethylenediaminetetraacetic acid, when reached at cell types of non-mesodermal lineage, such as neuronal ∼80% confluence. After being washed with D-PBS, the cells of ectodermal lineage and pancreatic cells of endoder- cells were fixed with 3.7% formaldehyde solution at 4°C mal lineage in three types of DPSCs, respectively. These overnight, and directly labeled with a fluorescein isothio- results suggest that DPSCs are an available source for cyanate (FITC)-conjugated mouse anti-CD34, CD44, application in regenerative medicine and stem cell research CD45, CD90 (BD, USA, 1:100) for 1 h on ice. Otherwise, with broader potentialities. FITC-unconjugated mouse anti-CD13, CD73 and CD105 (Santa Cruz, USA, 1:100) were incubated for 45 min at 37°C. Following washing with D-PBS, the cells were labeled with FITC-conjugated goat anti-mouse IgG (BD, Materials and methods USA) secondary antibody at 4°C for 1 h. The FITC- Isolation and culture of DSCs labeled 1 × 10 cells were used for flow cytometer (BD All chemicals were purchased from Sigma (USA) and FACS Calibur, USA) assay in each sample. All running media from Gibco (Invitrogen, USA), unless otherwise samples were analyzed with CellQuest software (BD, Animal Cells and Systems 323 USA) equipped with a flow cytometer. The standards were sample, using a Gelviewer image processing software established with isotype-matched control. (Innogene, Korea). Primer sequences, size of amplified products and annealing temperatures for GAPDH (glycer- aldehyde 3-phosphate dehydrogenase), OCT-4 (octamer- Analysis of transcripts expression by reverse binding transcription factor 4), Homeobox NANOG, transcription-polymerase chain reaction SOX-2 (sex determining region Y), NSE (neuron-specific enolase), MAP-2 (microtubule-associated protein-2), The expression level of stem-cell-specific and lineage- NESTIN, INSULIN, PDX-1 and GLUT-2 (glucose trans- specific transcripts in each of DPSC lines was analyzed porter 2) are presented in Table 1. by reverse transcription-polymerase chain reaction (RT- PCR). The total RNA was extracted using the QIAshredder column and RNeasy Micro Kit (Qiagen, USA). Homogen- Analysis of telomerase activity by real-time quantitative ization, isolation, precipitation and purification of RNA telomerase repeats amplification protocol were performed according to the manufacturer’s instruc- tions, with an extra step of DNase I treatment carried out To analyze the level of telomerase activity in each of DPSC for the removal of DNA contamination. The concentration lines, real-time quantitative telomerase repeats amplifica- of total RNA was determined by a spectrophotometer tion protocol (RQ-TRAP) assay using the LightCycler 3.0 (Mecasys, Korea). A total of 1 µg RNA was converted to PCR system (Roche, USA) was employed with modifi- the first-strand cDNA with Omniscript RT Kit (Qiagen), cation of a conventional TRAP-ELIZA assay, as previously according to the manufacturer’s protocols. Each of cDNA described (Jeon et al. 2011c). Briefly, cells were lysed in reactions contained 2 µl of 10 µM Oligi-dT primer CHAPS lysis buffer (Millipore, USA) at a density of 250 12–18 (Invitrogen), 1 µl of 10 U/µl RNase Inhibitor (Invitrogen), cells/µl for 30 min on ice. Lysed samples were centrifuged 2 µl of RT buffer, 2 µl dNTP and 1 µl of Omniscript at 12,000 × g at 4°C for 20 min to remove cell debris. The (Qiagen), adjusted to a total volume of 20 µl. All the reac- concentration of protein was measured by a spectropho- tion was run in triplicate for each RNA sample. The PCR tometer (Mecasys, Korea) and a total of 5 µg protein was amplification was carried out in a thermal cycler analyzed by the RQ-TRAP assay. The RQ-TRAP was opti- (TaKaRa, Japan) using Maxime-PCR PreMix Kit mized using the PCR reagent LightCycler FastStart DNA (iNtRON Biotechnology, Korea) for 30 cycles, in triplicate. Master SYBR Green 1 (Roche), according to the manufac- The PCR product was fractionated by 1% agarose gel elec- turer’s instructions, containing 2.5 mM MgCl , 0.02 µg of trophoresis. The relative quantification of transcripts was primer TS (5′-AAT CCG TCG GAG CAG AGT T-3′), calculated to a ratio based on the level of GAPDH (D-gly- 0.04 µg of primer ACX (5′-GCG CGG CTT ACC CTT ceraldehyde-3-phosphate dehydrogenase) in each cDNA ACC CTT ACC CTA ACC-3′). The assay was set up for Table 1. Primer sequences, amplification size and annealing temperature used for RT-PCR. Gene Primer sequences (5′–3′) Amplification size (bp) Annealing temp. (°C) GAPDH GAAGGTGAAGGTCGGAGTC 228 57 GAAGATGGTGATGGGATTTC OCT4 CGACCATCTGCCGCTTTGAG 577 65 CCCCCTGTCCCCCATTCCTA NANOG AGAAGGCCTCAGCACCTAC 205 60 GGCCTGATTGTTCCAGGATT SOX-2 CCCCCGGCGGCAATAGCA 448 59 TCGGCGCCGGGGAGATACAT NSE CATCGACAAGGCTGGCTACACG 328 60 GACAGTTGCAGGCCTTTTCTTC MAP-2 TTGGTGCCGAGTGAGAAGAA 280 55 GGTCATGCTGGCAGTGGTTGGT NESTIN CAGCGTTGGAACAGAGGTTGG 282 62 TGGCACAGGTGTCTCAAGGG INSULIN AGCCTTTGTGAACCAACACC 245 60 GCTGGTAGAGGGAGCAGATG PDX-1 TCCCATGGATGAAGTCTACC 246 60 TGTCCTCCTCCTTTTTCCAC GLUT2 AGGACTTCTGTGGACCTTATGTG 231 55 GTTCATGTCAAAAAGCAGGG 324 B.-G. Jeon et al. 30 min incubation at 30°C, followed by 10 min incubation incubated with FITC-conjugated secondary antibodies at 94°C, and 40 cycles of PCR at 94°C for 30 s and 60°C (Jackson Immunoresearch, donkey anti-goat IgG, USA, for 90 s. All samples were quantified using the LightCycler 1:200) for 1 h. Nucleus was counterstained with 1 μg/ Quantification Software’s (Roche, USA) second derivative ml 4′,6-diamidino-2-phenylindole (DAPI) for 5 min at method of crossing point determination, and relative telo- room temperature and the slides were mounted with Vec- merase activity was calculated to ratio based on the level tashield (Vector Laboratories, USA). Images were of telomerase activity in the 293T telomerase-positive cells. acquired under a fluorescence microscope (Leica CTR600, Switzerland) and expression levels of NSE, MAP-2 and NESTIN for pancreatic differentiation were In vitro differentiation into osteocytes, adipocytes, and analyzed by RT-PCR. chondrocytes Differentiation into pancreatic cells was induced with Each of the isolated DPSC lines was evaluated for their a three-stage protocol following previously published differentiation capacity into mesodermal osteocytes, adipo- protocols (Xie et al. 2009). Briefly, at stage 1, cells cytes and adipocytes, as previously published protocols were seeded at a density of 0.8–1×10 cell/well in (Kumar et al. 2012). Briefly, osteogenic differentiation DMEM with 10 ng/ml bFGF, 1% DMSO, 1% FBS and was induced in DMEM containing 1 μM dexamethasone, 23 mM glucose for 3 days. At stage 2, after being 10 mM sodium β-glycerophosphate and 0.05 mM ascorbic washed three times with PBS, the cells were cultured 3 2 acid at a density of 1 × 10 cell/cm . Calcium deposition in serum-free DMEM/F12 with 17.5 mM glucose, 1 was detected by von Kossa staining after 4 weeks. Adipo- mM nicotinamide, 20 ng/ml EGF, 20 ng/ml bFGF, 10 genic differentiation was induced in DMEM 10 μM nM exendin-4 (Sigma), B27 ( × 50) and N2 ( × 100) for insulin, 100 μM indomethacin, 500 μM isobutyl methyl- 7 days. At stage 3, the cells were cultured in RPMI xanthine and 1 μM dexamethasone. After 4 weeks, oil dro- 1640 with 11.1 mM glucose, 10 mM nicotinamide, 10 plets in differentiated adipocytes were evaluated by Oil red mM Hepes, 100 pM HGF, 2 nM activin-A and 10 nM O staining. Chondrogenic differentiation was induced in exendin-4 for 5 days. Pancreatic β-cells were analyzed confluent monolayer cultures with 5 ng/ml transforming with dithizone (DTZ) cytochemical staining under growth factor-b1 (R&D systems, USA), 0.1 μM dexa- phase contrast microscopy (Nikon, Japan) and expression methasone, 50 mg/ml ascorbic acid, 100 mg/ml sodium levels of pancreatic-specific transcripts, INSULIN, PDX- pyruvate, 40 mg/ml L-proline and 50 mg/ml ITS + premix 1 and GLUT-2 were analyzed by RT-PCR. (6.25 mg/ml insulin, 6.25 mg/ml transferrin, 6.25 ng/ml selenious acid, 1.25 mg/ml BSA and 5.35 mg/ml linoleic Statistical analysis acid). Proteoglycan deposition was assessed by Alcian One-way analysis of variance (ANOVA) was employed to blue 8GX solution after 21 days. analyze the differences (SPSS 15.0, Chicago, IL, USA) and the data were expressed as mean ± SEM. Comparisons of In vitro differentiation into neuronal and pancreatic cells mean values were analyzed using Tukey’smultiple compari- sons test. The level of significance was tested when P <.05. Neuronal differentiation of ectodermal lineage was induced in three DPSC lines, as previously published pro- tocols (Woodbury et al. 2000; Kumar et al. 2012). Results Briefly, each of DPSC lines at 80% confluence was cul- Analysis of cell surface markers in each of DPSC lines tured in A-DMEM supplemented with 20% FBS, 1 mM b-mercaptoethanol and 10 ng/ml basic fibroblast growth Stem-cell-specific cell surface markers expressed in each factor for 24 h. And the cells were subsequently cultured of three DPSC lines by fluorescence-activated cell sorting in DMEM supplemented with 2% dimethyl sulfoxide are shown in Figure 1. A high expression level (∼over (DMSO), 200 μM butyrated hydroxyanisole, 2 mM val- 94%) of CD13, CD44, CD73, CD90 and CD105 was proic acid, 10 μM forskolin, 5 μg/ml insulin, 1 μM hydro- observed in each of the DPSC lines; in contrast, the cortisone and 25 mM KCl for 6 days. Following expression levels of CD34 and CD45 were detected at a differentiation induction into neuronal cells in 13 mm low level (∼5%). The expression level in both positive slips, expression of neuronal-specific neuro-filament M and negative cell surface markers was not significantly (NF-M) was analyzed with immunofluorescence staining. (P < .05) different among three of DPSC lines. Briefly, differentiated neuronal cells were fixed in 3.7% paraformaldehyde for overnight and permeabilized by Expression of stem-cell-specific transcripts in DPSC lines 0.2% Triton X-100 for 30 min. Then, the cells were incu- bated at 4°C for overnight with the NF-M monoclonal The expression level of NANOG, SOX-2 and OCT-4 tran- primary antibodies (Santa Cruz, USA, goat IgG, 1:100). scription factors was analyzed by RT-PCR in each of three After being washed with PBS, cells were subsequently DPSCs (Figure 2). Expression of both of NANOG and Animal Cells and Systems 325 Figure 1. Expression analysis (%, mean ± SEM) of cell surface markers in three DPSC lines. CD13, CD44, CD73, CD90 and CD105 were used as a positive marker. CD34 and CD45 were used as a negative marker. A representative example of three DPSC lines is shown. SOX-2 was significantly (P < .05) higher in DPSCs 3 than weeks of differentiation induction, osteocytes with minera- those of DPSCs 1 and DPSCs 2. Expression of OCT-4 in lized matrix were evaluated by von Kossa staining (Figure DPSCs 3 was not significantly (P < .05) different compared 4(a)). Adipocytes with multivacuolar neutral lipid droplets to that of DPSCs 1, but significantly (P < .05) lower than were also demonstrated by oil red O staining (Figure 4(b)). that of DPSCs 2. Further, expression of NANOG was Moreover, extracellular matrix containing sulfated proteo- detected at generally high levels, compared with other glycans was proved by Alcian blue 8GX staining in the stem-cell-specific transcripts, SOX-2 and OCT-4. Other- cells differentiated into chondrocytes (Figure 4(c)). All wise, expression of these transcription factors was not DPSC lines derived from dental papilla tissues were detected in the MRC-5 fibroblasts used as somatic cell observed to be easily differentiated into osteocytes, adipo- controls. cytes and chondrocytes. Analysis telomerase activity in DPSC lines Differentiation capacity of DPSC lines into neuronal cells Result of telomerase activity analyzed by RQ-TRAP in Differentiation capacity into neuronal cells of ectodermal each of three DPSC lines was described in Figure 3. Telo- lineage under specific culture condition was evaluated in merase activity in three DPSC lines was relatively calcu- each of three DPSC lines (Figure 5). After 10 days of lated, compared to that of 293T telomerase-positive cells induction, cells were gradually changed to typical considered as 100%. Telomerase activity was found to be neuron-like cells with multipolar and round cell bodies 17.1 ± 7.56%, 16.9 ± 7.45% and 20.8 ± 4.12% in DPSCs to form neural networks (Figure 5(b)). Expression of 1, DPSCs 2 and DPSCs 3, respectively. The telomerase neuronal-cell-specific protein (NF-M) was confirmed by activity showed no significant (P < .05) difference among immunofluorescence staining (Figure 5(c)). However, three DPSC lines. However, its expression level in all round-cell-bodies-like structure was observed, but three DPSC lines was detected at a very low level network-like structure was not observed in MRC-5 fibro- (∼20%), compared to that of 293T telomerase-positive blasts as somatic control cells after induction into neur- cells and similar with MRC-5 fibroblasts. onal cells (Figure 5(d)). Further, expression of neuronal- cell-specific transcripts (NSE, MAP-2 and NESTIN) was verified by RT-PCR in three DPSC lines. However, Differentiation capacity of DPSC lines into osteocytes, the expression level of NESTIN was significantly (P adipocytes and chondrocytes < .05) lower in DPSCs 3 than those of DPSCs 1 and Three DPSC lines were evaluated for their differentiation DPSCs 2 (Figure 5(d)). However, expression of these capacity into osteocytes, adipocytes and chondrocytes of genes was not detected in the untreated DPSCs used as mesodermal lineage, as shown in Figure 4. After 3–4 negative controls. 326 B.-G. Jeon et al. Figure 3. Telomerase activity by RQ-TRAP assay in three DPSC lines, respectively. Values indicated the mean telomease activity (mean ± SEM) of five replicates and telomerase activity in 293T telomerase-positive cells was considered as 100% for comparison with DPSC lines. The telomerase activity in three DPSC lines was similar with MRC-5 somatic control fibroblasts at a low level, compared with 293T telomerase-positive cells. by RT-PCR in three DPSC lines. Expression of INSULIN was not significantly (P < .05) different among the three DPSC lines. Expression of PDX-1 was significantly (P < .05) higher in DPSCs 1 than those of DPSCs 2 and DPSCs 3. Expression of GLUT-2 in DPSCs 2 was not sig- Figure 2. Expression of NANOG, OCT-4, and SOX-2 transcrip- tion factors by RT-PCR in three DPSC lines, respectively. Values nificantly (P < .05) different compared to that of DPSCs 1, indicated the mean transcript levels (mean ± SEM) of three repli- but significantly (P < .05) lower than that of DPSCs cates and were calculated as the ratio based on the level of 3. However, expression of these genes was also not GAPDH. Their expression was not detected in the MRC-5 fibro- detected in the untreated DPSCs used as negative controls. blasts used as somatic cell controls. a and b indicate significant (P < .05) difference on OCT-4 transcript among DPSC lines, respect- ively. A and B indicate difference on NANOG transcript among DPSC lines, respectively, * and ** indicate significant (P < .05) Discussion difference on SOX-2 transcript among DPSC lines, respectively. Cell therapies using MSCs isolated from various fetal or adult tissues were considered as a powerful tool in the fields of regenerative medicine and tissue engineering, Differentiation capacity of DPSC lines into pancreatic due to their multipotent differentiation capacity into cells various specialized cell types. In the present study, three Differentiation capacity into pancreatic cells of endodermal different MSC lines derived from dental papilla tissues lineage was also evaluated by DTZ cytochemical staining (DPSCs) were investigated on the fundamental cellular and RT-PCR in each of three DPSC lines (Figure 6). characterizations of MSCs, including the expression of Under specific culture condition using three-stage proto- CD surface markers, stem-cell-specific transcripts, level cols, cells at stage 1 were changed to round but star-like of telomerase activity, differentiation capacity into meso- shape from fibroblasts-like characteristics (Figure 6(a)). dermal osteocytes, adipocytes and chondrocytes of meso- After the completion of differentiation induction during dermal lineage. Subsequently, differentiation capacity the next two stage, cells were formed into spheroid clusters. into ectodermal neuronal cells and endodermal pancreatic Most of spheroid clusters were positively stained with DTZ cells was also examined in these DPSC lines. We demon- cytochemical solution that reacted with pancreatic β-cell strated that all DPSC lines used in the present study (Figure 6(b)). However, some cells with spheroid clusters exhibit their fundamental cellular characterizations were not stained with DTZ cytochemical solution (Figure related to MSCs and possess differentiation capacity into 6(c)). Any morphological alterations, such as spheroid ectodermal neuronal cells and endodermal pancreatic clusters, were not observed in MRC-5 fibroblasts as cells as well. somatic control cells after induction into pancreatic cells Our earlier studies have examined that the fundamental (Figure 6(d)). Expression of pancreas-specific transcripts, MSCs characterizations on the expression of CD surface INSULIN, PDX-1 and GLUT-2, was further confirmed markers, reverse transcriptase activity, and telomere Animal Cells and Systems 327 Figure 4. In vitro differentiation capacity into osteocytes (a), adipocytes (b) and chondrocytes (c) of mesodermal lineage in DPSC lines. Formation of a mineralized matrix in the osteocytes was revealed by Von Kossa staining (a). Intracellular accumulation of neutral lipids in the adipocytes was demonstrated by staining with oil red O solution (b). Synthesis of sulfated proteoglycans was viewed by Alcian blue staining (c). Scale: 50 μm. A representative example of three DPSC lines is shown. length and telomerase activity in each type of MSC derived in MSCs, whereas CD13, CD44, CD73, CD90 and CD105 from human dental papilla, pulp and follicle tissues (Jeon are positive-cell-surface CD markers, strongly expressed in et al. 2011a, 2011b). Especially, a higher expression level MSCs. Thus, the profile of specific cell-surface markers of these MSCs characteristics was observed in the dental has been generally used for defining MSCs (Dominici papilla tissues, when compared to those of the MSCs et al. 2006; Jeon et al. 2011a, 2011b; Corselli et al. 2013; derived from dental pulp/follicle, adipose, skin and bone Patil et al. 2014). In the present study, expression of marrow (Jeon et al. 2011a, 2011b). CD34 and CD45 are CD34 and CD45 was at a lower level (∼below 5%) and negative-cell-surface CD markers, which are not expressed CD13, CD44, CD73, CD90 and CD105 were strongly Figure 5. In vitro differentiation capacity into neuronal cells of ectodermal lineage and expression of neuron-specific transcripts in three DPSC lines. (a) Undifferentiated DPSCs at pre-induction stage. (b) DPSCs were altered into typical neuron-like cells that form large clus- ters of cell bodies and network-like structure at day 10 after neuronal induction. (c) Expression of NF-M neuronal marker (green) was confirmed by immunofluorescence staining. DNA was counterstained with DAPI (blue). (d) Round-cell-bodies-like structure without a network-like structure was only observed in MRC-5 fibroblasts as somatic control cells after induction into neuronal cells. Scale bar, 50 μm. (e) Expression of neuron-specific transcripts, NSE, MAP-2 and NESTIN, were further examined by RT-PCR in three DPSC samples. Values indicated the mean transcript levels (mean ± SEM) of three replicates and calculated to ratio based on the level of GAPDH. Their expression was not detected in the untreated DPSCs used as negative controls. a–d indicate significant (P < .05) difference on NESTIN transcript among three DPSC lines. A representative example of three DPSC lines is shown. 328 B.-G. Jeon et al. Figure 6. In vitro differentiation capacity into pancreatic cells of endodermal lineage and expression of pancreas-specific transcripts in three DPSC lines. (a) During three days (first stage) of induction, DPSCs with fibroblasts-like morphological characteristics were gradually altered into round but star-like shape (arrow). (b) After completion of induction during next two stage, spheroid clusters were observed in three DPSC lines and the clusters were positively stained with DTZ solution. (c) Spheroid clusters were formed but unstained with DTZ solution in differentiated cells. (d) Morphological alterations were not observed in MRC-5 fibroblasts as a somatic control cell after induc- tion into pancreatic cells. Scale bar: 50 μm. (e) Expression of pancreas-specific transcripts, INSULIN, PDX-1 and GLUT-2, were further examined by RT-PCR. Values indicated the mean transcript levels (mean ± SEM) of three replicates and calculated to ratio based on the level of GAPDH. Their expression was not detected in the untreated DPSCs used as negative controls. A and B indicate significant (P < .05) difference on GLUT-2 transcript among three DPSC lines, respectively. a and b indicate significant (P < .05) difference on PDX- 1 transcript among three DPSC lines, respectively. A representative example of three DPSC lines is shown. expressed (∼over 95%) without any significant differences studies may be due to various isolation techniques, age among three DPSC lines. However, the expression level of of the donor, passage level and experimental condition CD markers was slightly different when compared with employed during the study. Previous studies have that in our previous study (Jeon et al. 2011a, 2011b). suggested that the isolation of these rare stem cells in pur- Further, NANOG, OCT-4 and SOX-2 transcription ified state from various tissues is considerably difficult factors play an important role in maintenance of stemness, (Alison & Islam 2009). Moreover, it has been demon- including pluripotency and self-renewability of the MSCs strated that expression levels of these transcripts slightly (Czyz et al. 2003; Kashyap et al. 2009; Rodgerson & differ along with origin and isolation methods of MSCs Harris 2011). It has been reported in previous others (Song et al. 2011). studies that these transcription factors are abundantly Telomeric repeats play a central role in DNA protec- expressed in various human and porcine bone-marrow-, tion, which exists at the end of eukaryotic chromosomes skin-, adipose- and dental-derived MSCs (Ock et al. and a high level of telomerase activity can add a repeating 2010; Song et al. 2011; Patil et al. 2014). These transcrip- telomeric sequence to the end of eukaryotic chromosomes tion factors in the present study were uniformly expressed (Artandi & DePinho 2010). In our previous studies, telo- in all DPSC lines. However, the expression level of these meric repeats in various types of human MSC lines was transcripts was slightly variable, compared to those of pre- markedly longer than those of cancer and normal cell vious studies. The expression level of NANOG was higher lines (Jeon et al. 2011a, 2011b, 2011c). However, it is a than OCT-4 and SOX-2 in all three DPSC lines used in the well-known fact that telomerase activity is down-regulated present study. Whereas, it has been reported that the in most of the MSCs derived from adult tissues, including expression level of OCT-4 and SOX-2 was markedly dental as well as bone marrow, skin and adipose, compared higher than NANOG in MSCs derived from bone to those of cancer or embryonic stem cells with higher pro- marrow and skin tissue of mini-pig and human DPSCs liferative capacity (Jeon et al. 2011a, 2011b). Telomerase (Ock et al. 2010; Patil et al. 2014). Further, NANOG, activity was also detected at a very low level in all DPSC OCT-4 and SOX-2 transcripts were evenly expressed in lines used in the present study, compared to that of 293T MSCs derived from skin, adipose and ovarian tissues telomerase-positive cells. Meanwhile, it has been reported (Song et al. 2011). The difference on expression patterns that telomerase activity is slightly up-regulated in DPSCs of transcription factors and CD markers in each of the derived from dental papilla tissue, compared to those of Animal Cells and Systems 329 dental pulp/follicle MSCs and bone marrow MSCs (Jeon NESTIN transcripts was also at a high level than those of et al. 2011b). Even though it has been suggested in other both NSE and MAP-2. Previous several reports have also studies that telomeric repeats in various MSCs with low shown that MSCs derived from porcine and human bone level of telomerase activity were maintained by mechan- marrow, umbilical cord and adipose tissues possess their isms of alternative lengthening of telomeres (Reddel ability to form neuron-like cells (Huang et al. 2007; et al. 2001; Hensen et al. 2002), maintenance/alteration Kumar et al. 2012; Jadalannagari & Aljitawi 2014; Liu of telomeric repeats in various MSCs is still not well under- et al. 2015). Recently, MSCs derived from human dental stood. Even if exactly authentic or purified MSCs are also papilla tissues showed to be differentiated into neuronal isolated from tissues with complex and various cells, their cells (Gervois et al. 2015). In these previous reports, the MSCs might possess up-regulated telomerase activity to expression level of neuron-specific transcripts such as the level of ESCs or cancer cells. In the present study, we MAP-2 was slightly different when compared to that in demonstrated that DPSCs used in the present study lines our study. These variations of neuron-specific transcripts possess fundamental stemness characteristics, but further are thought to be minor differences along with origin and exploration on down-regulated level of telomerase activity differentiation conditions of MSCs. related with alterations of telomeric repeats should be eval- Insulin-producing pancreatic cells are very interesting in uated in MSC, including DPSCs. regenerative medicine for controlling blood glucose and It has been strongly emphasized that the most important differentiation capacity into pancreatic cells has been tried criterion to characterize MSCs is their capacity to differen- in various types of human MSCs, such as bone marrow tiate into specialized cell types (Dominici et al. 2006). and adipose-derived MSCs (Tang et al. 2004; Xie et al. These MSCs with multipotent capacity should be tested 2009; Kim et al. 2012; Karaoz et al. 2013; Moshtagh et al. in clinical studies and applications. Many reports have 2013). We also examined the differentiation plasticity into widely demonstrated that MSCs derived from dental, pancreatic cells of endodermal lineage in three DPSC bone marrow, skin, fat tissues, umbilical cord matrix of lines derived from human dental papilla under controlled human, porcine and others can be easily efficiently differ- culture conditions in vitro. Differentiation plasticity into entiated into mesenchyme cell types of mesodermal lineage endodermal pancreatic cells with morphologically spheroid (such as bone, fat and cartilage) under suitable in vitro cluster was observed in all DPSC lines used in the present induction conditions with specific chemicals (Jeon et al. study. Further, basic cellular characterizations exhibited in 2011a, 2011b; Song et al. 2011; Kumar et al. 2012; Patil pancreatic cells were subsequently confirmed by DTZ stain- et al. 2014). In support of these previous observations, all ing to selectively stain pancreatic cells and expression of DPSC lines used in the present study were successfully dif- pancreas-specific transcripts, such as INSULIN, PDX-1, ferentiated into mesodermal osteocytes, adipocytes and and GLUT-2, using RT-PCR. INSULIN transcript was chondrocytes lineage, as evidenced by special cytochem- evenly expressed in all DPSC lines differentiated into pan- ical staining. Furthermore, even though all MSCs are creatic cells, but both of PDX-1 and GLUT-2 transcripts derived from the mesoderm layer in process of embryo have revealed to be expressed with slight variations, development, it has been demonstrated that human and depending on DPSCs cell types used. porcine MSCs derived from various tissues are success- It has been demonstrated by previous studies that the fully differentiated into non-mesodermal lineage, including expression of pancreas-specific transcripts are observed ectodermal lineage and endodermal lineage, also known as in differentiated bone-marrow-derived MSCs with spher- plasticity or transdifferentiation capacity (Song et al. 2011; oid cluster (Xie et al. 2009; Kim et al. 2012; Karaoz Kumar et al. 2012; Patil et al. 2014). Following induction et al. 2013; Moshtagh et al. 2013). However, some of to neuronal differentiation under controlled culture con- these spheroid clusters were not stained with DTZ cyto- ditions, all DPSCs used in this study clearly showed their chemical solution and also these DPSC lines possess a rela- differentiation plasticity into ectodermal lineage by mor- tively poor capacity to differentiate into pancreatic cells phologically forming neuron-like cells. Moreover, basic when compared to that of neuronal differentiation. Other- cellular characterizations of differentiated neuronal cells wise, it has been suggested in other reports that DPSCs are also confirmed by the expression of neuron-specific from dental papilla tissues originate from neural crest of transcripts, such as NSE, MAP-2 and NESTIN, using ectodermal lineage during the process of embryo develop- RT-PCR and evidence of NF-M using immunofluorescence ment (Rothová et al. 2011; Akiyama et al. 2012) and the staining. In the present study’s results, all DPSC lines were DPSCs from neural crest should be easily differentiated easily differentiated into neuronal cells, but the expression into ectodermal neural cells than endodermal pancreatic level of neuron-specific transcripts was slightly different cells. Apart from a contrasting opinion on DPSCs of among three DPSC lines. In the present study, the origin, these DPSCs have represented an advantage that expression level of NESTIN transcripts especially was at populations of more purified MSCs are easily isolated a high level in both of DPSCs 1 and DPSCs 2 lines than from tissues of needless extracted tooth, compared to that of DPSCs 3 lines. Moreover, the expression level of those of others tissues (such as bone marrow, skin and 330 B.-G. Jeon et al. Gervois P, Struys T, Hilkens P, Bronckaers A, Ratajczak J, Politis adipose) with relatively more complex and diverse cells C, Brône B, Lambrichts I, Martens W. 2015. Neurogenic (Jeon et al. 2011a, 2011b). Thus, we suggested that these maturation of human dental pulp stem cells following neuro- dental-tissues-derived MSCs might be a useful candidate sphere generation induces morphological and electrophysio- for studying molecular changes during pancreatic logical characteristics of functional neurons. Stem Cells transdifferentiation. Dev. 24:296–311. Henson JD, Neumann AA, Yeager TR, Reddel RR. 2002. In conclusion, we demonstrated that three DPSC lines Alternative lengthening of telomeres in mammalian cells. derived from dental tissues exhibit outstanding fundamen- Oncogene. 21:598–610. tal stemness characterizations on expression of CD markers Huang G, Ye S, Zhou X, Liu D, Ying QL. 2015. Molecular basis and stem-cell-specific transcripts, although these DPSC of embryonic stem cell self-renewal: From signaling path- lines showed a low level of telomerase activity. Further, ways to pluripotency network. Cell Mol. 72:1741–1757. Huang T, He D, Kleiner G, Kuluz J. 2007. Neuron-like differen- these DPSCs exhibited the capacity to differentiate into tiation of adipose-derived stem cells from infant piglets in mesodermal osteocytes, adipocytes and chondrocytes vitro. J Spinal Cord Med. 30;Suppl. 1:S35–S40. lineages, as well as ectodermal neuronal and endodermal Jadalannagari S, Aljitawi OS. 2014. Ectodermal differentiation of pancreatic cells lineage with least potency. Our results Wharton’s jelly mesenchymal stem cells for tissue engineer- suggested that DPSC lines should be a reliable source of ing and regenerative medicine applications. Tissue Eng Part B. 21:314–322. MSCs, possibly contributing to the regenerative medicine Jeon BG, Kang EJ, Kumar BM, Maeng GH, Ock SA, Kwack DO, and tissue engineering. Park BW, Rho GJ. 2011a. Comparative analysis of telomere length, telomerase and reverse transcriptase activity in human dental stem cells. Cell Transplant. 20:1693–1705. Disclosure Statement Jeon BG, Kumar BM, Kang EJ, Ock SA, Lee SL, Kwack DO, Byun JH, Park BW, Rho GJ. 2011b. Characterization and No potential conflict of interest was reported by the authors. comparison of telomere length, telomerase and reverse tran- scriptase activity and gene expression in human mesenchy- mal stem cells and cancer cells of various origins. Cell Funding Tissue Res. 345:149–161. This study was supported by Bio-industry Technology Develop- Jeon BG, Kwack DO, Rho GJ. 2011c. Variation of telomerase ment Programme (IPET-312060–5), Ministry for Food, Agricul- activity and morphology in porcine mesenchymal stem cells ture, Forestry and Fisheries, Republic of Korea. and fibroblasts during prolonged in vitro culture. Anim Biotechnol. 22:197–210. Karaoz E, Okcu A, Ünal ZS, Subasi C, Saglam O, Duruksu G. References 2013. Adipose tissue-derived mesenchymal stromal cells effi- ciently differentiate into insulin-producing cells in pancreatic Akiyama K, Chen C, Gronthos S, Shi S. 2012. Lineage differen- islet microenvironment both in vitro and in vivo. tiation of mesenchymal stem cells from dental pulp, apical Cytotherapy. 15:557–570. papilla, and periodontal ligament. Methods Mol Biol. Kashyap V, Rezende NC, Scotland KB, Shaffer SM, Persson JL, 887:111–121. Gudas LJ, Mongan NP. 2009. Regulation of stem cell pluripo- Alison MR, Islam S. 2009. Attributes of adult stem cells. J Pathol. tency and differentiation involves a mutual regulatory circuit 217:144–160. of the NANOG, OCT4, and SOX2 pluripotency transcription Artandi SE, DePinho RA. 2010. Telomeres and telomerase in factors with polycomb repressive complexes and stem cell cancer. Carcinogenesis. 31:9–18. microRNAs. Stem Cells Dev. 18:1093–1108. Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Kim SJ, Choi YS, Ko ES, Lim SM, Lee CW, Kim DI. 2012. Smith A. 2003. Functional expression cloning of Nanog, a Glucose-stimulated insulin secretion of various mesenchymal pluripotency sustaining factor in embryonic stem cells. Cell. stem cells after insulin-producing cell differentiation. J Biosci 113:643–655. Bioeng. 113:771–777. Cheng PH, Snyder B, Fillos D, Ibegbu CC, Huang AHC, Chan Kumar BM, Maeng GH, Lee YM, Kim TH, Lee JH, Jeon BG, AWS. 2008. Postnatal stem/progenitor cells derived from Ock SA, Yoo JG, Rho GJ. 2012. Neurogenic and cardiomyo- the dental pulp of adult chimpanzee. BMC Cell Biol. 9:20. genic differentiation of mesenchymal stem cells isolated from Corselli M, Crisan M, Murray IR, West CC, Scholes J, Codrea F, minipig bone marrow. Res Vet Sci. 93:749–757. Khan N, Péault B. 2013. Identification of perivascular Lee YM, Kumar BM, Lee JH, Lee WJ, Kim TH, Lee SL, Ock SA, mesenchymal stromal/stem cells by flow cytometry. Jeon BG, Park BW, Rho GJ. 2013. Characterisation and Cytometry A. 83A:714–720. differentiation of porcine ovarian theca-derived multipotent Czyz J, Wiese C, Rolletschek A, Blyszczuk P, Cross M, Wobus stem cells. Vet J. 197:761–768. AM. 2003. Potential of embryonic and adult stem cells in Liu Q, Cheng G, Wang Z, Zhan S, Xiong B, Zhao X. 2015. Bone vitro. Biol Chem. 384:1391–1409. marrow-derived mesenchymal stem cells differentiate into Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini nerve-like cells in vitro after transfection with brain-derived F, Krause D, Deans R, Keating A, Prockop Dj, Horwitz E. neurotrophic factor gene. In Vitro Cell Dev Biol Anim. 2006. Minimal criteria for defining multipotent mesenchymal 51:319–327. stromal cells. Cytotherapy. 8:315–317. Moshtagh PR, Emami SH, Sharifi AM. 2013. Differentiation of Du ZW, Chen H, Liu H, Lu J, Qian K, Huang CL, Zhong X, Fan human adipose-derived mesenchymal stem cell into insulin- F, Zhang SC. 2015. Generation and expansion of highly pure producing cells: an in vitro study. J Physiol Biochem. motor neuron progenitors from human pluripotent stem cells. 69:451–458. Nat Commun. 6:6626. Animal Cells and Systems 331 Nauta AJ, Fibbe WE. 2007. Immunomodulatory properties of multipotent stem/stromal cells derived from skin, adipose, mesenchymal stromal cells. Blood. 110:3499–3506. and ovarian tissues and their differentiation in vitro into puta- Ock SA, Jeon BG, Rho GJ. 2010. Comparative characterization tive oocyte-like cells. Stem Cells Dev. 20:1359–1370. of porcine mesenchymal stem cells derived from bone Tang DQ, Cao LZ, Burkhardt BR, Xia CQ, Litherland SA, marrow extract and skin tissues. Tissue Eng Part C Atkinson MA, Yang LJ. 2004. In vivo and in vitro character- Methods. 16:1481–1491. ization of insulin-producing cells obtained from murine bone Patil R, Kumar BM, Lee WJ, Jeon RH, Jang SJ, Lee YM, Park BW, marrow. Diabetes. 53:1721–1732. Byun JH, Ahn CS, Kim JW, Rho GJ. 2014. Multilineage Wang F, Yu M, Yan X, Wen Y, Zeng Q, Yue W, Yang P, Pei X. potential and proteomic profiling of human dental stem cells 2011. Gingiva-derived mesenchymal stem cell-mediated derived from a single donor. Exp Cell Res. 320:92–107. therapeutic approach for bone tissue regeneration. Stem Reddel RR, Bryan TM, Colgin LM, Perrem KT, Yeager TR. 2001. Cells Dev. 20:2093–2102. Alternative lengthening of telomeres in human cells. Radiat Woodbury D, Schwarz EJ, Prockop DJ, Black IB. 2000. Adult rat Res. 155:194–200. and human bone marrow stromal cells differentiate into Rodgerson DO, Harris AG. 2011. A comparison of stem cells for neurons. J Neurosci Res. 61:364–370. therapeutic use. Stem Cell Rev. 7:782–796. Xie QP, Huang H, Xu B, Dong X, Gao SL, Zhang B, Wu YL. Rothová M1, Feng J, Sharpe PT, Peterková R, Tucker AS. 2011. 2009. Human bone marrow mesenchymal stem cells Contribution of mesoderm to the developing dental papilla. differentiate into insulin-producing cells upon micro- Int J Dev Biol. 55:59–64. environmental manipulation in vitro. Differentiation. Sensebé L, Krampera M, Schrezenmeier H, Bourin P, Giordano 77:483–491. R. 2010. Mesenchymal stem cells for clinical application. Yan L, Han Y, Wang J, Liu J, Hong L, Fan D. 2007. Effects of Vox Sang. 98:93–107. Notch-1 signalling pathway on differentiation of marrow Song SH, Kumar BM, Kang EJ, Lee YM, Kim TH, Ock SA, Lee mesenchymal stem cells into neurons in vitro. Neuroreport. SL, Jeon BG, Rho GJ. 2011. Characterization of porcine 18:1443–1447.
http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png
Animal Cells and Systems
Taylor & Francis
http://www.deepdyve.com/lp/taylor-francis/differentiation-potential-of-mesenchymal-stem-cells-isolated-from-xsxNa8Bi41
