Abstract
ANIMAL CELLS AND SYSTEMS 2019, VOL. 23, NO. 3, 170–175 https://doi.org/10.1080/19768354.2019.1595141 Endothelin-converting enzyme-1 expression in acute and chronic liver injury in fibrogenesis a,b b a,b Tae-Jun Cho , Hyo-Jung Kim and Jaejin Cho Labratory of Developmental Biology and Stem Cell Differentiation/Transplantation, Department of Dental Regenerative Biotechnology, School of Dentistry, Seoul National University South Korea, Seoul, South Korea; Dental Research Institute, Seoul National University, Seoul, South Korea ABSTRACT ARTICLE HISTORY Received 17 December 2018 Endothelin-1 (ET-1) induces contraction, proliferation, and collagen synthesis of activated hepatic Revised 22 February 2019 stellate cells and is a potent mediator of portal hypertension. Endothelin-converting enzyme-1 Accepted 7 March 2019 (ECE-1) generates ET-1 from the inactive precursor big-endothelin-1. The cellular distribution and activity of ECE-1 in the liver is unknown. Hepatic fibrogenesis was induced in rats by CCl KEYWORDS administration and secondary biliary cirrhosis after 6 weeks of complete bile duct occlusion Endothelin-converting (BDO). The tissue ET-1 and ET receptor protein levels were quantified, the ECE-1 isoform mRNAs enzyme-1; endothelin-1; were measured by RNase protection assay and ECE-1 activity was analyzed. ECE-1a and -b mRNA hepatic fibrogenesis; were upregulated in biliary cirrhosis and in CCl -injured livers, whereas ECE-1c mRNA remained endothelin receptor unchanged. ECE-1 activity was increased after BDO and peaked at 12 h after acute CCl - intoxication. Tissue levels of ET-1, ET - and ET receptors were elevated 7-, 5-, and 4.6-fold in A B cirrhotic rats, respectively. ECE-1 activity increased following BDO and acute CCl -intoxication. In conclusion, ECE-1a and -b RNAs are upregulated in fibrogenesis, indicating that these isoforms play a central role in ET-1 generation during fibrogenesis and portal hypertension. Introduction common to all ECE-1 isoforms (Valdenaire et al. 1995; Orzechowski et al. 1997; Schweizer et al. 1997). Further- Endothelins (ETs) comprise a family of three homologous more, an additional isoform that is generated from 21-amino acid oligopeptide vasoactive mediators (ET-1, exon 1d located within the small (approx.. 200 bp) ET-2, and ET-3) that trigger various biological effects genomic region between exon 1b and exan 2, ECE-1d, through G protein-coupled specific receptors, namely was recently identified (Muller et al. 2003). ECE-1 is upre- the ET receptor and ET receptor (ET R and ET R, A B A B gulated in congestive heart failure (Kohan et al. 2011), respectively). ET-1 usually induces a long-lasting vaso- gastric injury (Slomiany and Slomiany 2005) and buccal constriction via ET R and vasodilation via ET R (Barman A B mucosal ulcer healing after chronic alcohol ingestion in 2007; Martell et al. 2010; Ling et al. 2012). rats (Slomiany et al. 2000), and in lung cancer (Moody The biological precursor of ET-1, prepro-ET-1, is con- et al. 2017). verted to biologically active ET-1 through two steps. In the liver, the endothelin system is a modulator of Initial cleavage of two basic amino acids by a furin-like portal hypertension and fibrogenesis. Mediated through enzyme results in big-ET-1, which is further processed the ET R, ET-1 stimulates proliferation and contraction by cleavage of a Trp-Val bond by endothelin converting of hepatic stellate cells (HSC). This profibrogenic effect enzyme-1 (ECE-1) producing biologically active ET-1. was significantly ameliorated in a model of rat biliary ECE-1 is a membrane-bound, phosphoramidon-sensitive fibrosis following bile duct occlusion (BDO) by treatment metalloproteinase (Rodriguez-Pascual et al. 2014). with an orally active, highly specificET R antagonist, as Several ECE-1 isoforms have been identified (Figure 1). evidenced by reduced hepatic collagen accumulation ECE-1b and -c are characterized by isoform-specific exon (Cho et al. 2000). As a key enzyme to the ET-1/ET recep- 1, which are spliced to exon 2 that is common to both of tor-system, ECE-1 and its isoforms may constitute these isoforms. ECE-1a is transcribed from an alternative additional targets for pharmacological intervention. A promoter located about 11 kb downstream of exon recent study suggested that ECE-1 transcripts were down- 2. The 5 -terminus of exon 3 is the first ECE-1a specific regulated, whereas ECE-1 protein expression was exon, whereas the 3 -terminal part of this exon is CONTACT Jaejin Cho jcho@snu.ac.kr Department of Dental Regenerative Biotechnology, School of Dentistry, Seoul National University, 101, Daehak-ro, Jongno-gu, Seoul, South Korea © 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. MOLECULAR & CELLULAR BIOLOGY ANIMAL CELLS AND SYSTEMS 171 Determination of hepatic ET-1, and of ET and ET A B receptor levels Analysis of tissue ET-1 concentration was conducted as previously described (Cho et al. 2000; Kocyigit et al. 2018). Briefly, Snap-frozen liver tissue (approx. 200 mg) was powdered in liquid nitrogen and homogenized at 4° C. Homogenates were then centrifuged at 4°C for 60 min at 100,000 × g, after which supernatants were analyzed for ET-1 content using the commercial enzyme immunoas- say (Biomedica, Vienna, Austria). Cross-reactivities were as follows: ET-1 (1–21): 100%; ET-2 (1–21): 100%; ET-3 (1–21): < 5%; big-ET-1 (1–38): < 1%; big-ET-2 (22–38): < 1%. ET Figure 1. Genomic structure and mRNA isoforms generated from receptors were determined by radioligand assays (Cho the rat ECE-1 gene. Note: The genomic structure of the 5 -terminal part of the rat ECE-1 gene with et al. 2000) in the presence or absence of the subtype- exon-intron boundaries and localizations of the alternative promoters is specific endothelin receptor antagonists BQ123 (3 µmol/ shown in the upper part. Exons 4–19, which are common to all isoforms, l, ET R specific) (Sigma, St. Louis, USA) and/or BQ3020 are not shown. ECE-1 isoforms 1a, 1b, and 1c transcribed by different promo- A ters are shown in the lower part. (3 µmol/l, ET R specific) (Sigma, St. Louis, USA). Next, 1 ml of cold binding buffer was added and centrifugated at 30,000 × g and 4°C for 15 min and receptor-bound increased in hepatic stellate cells isolated from fibrotic rat [ I]-ET-1 was counted in a Packard Gamma Counter livers. Furthermore, the activity of ECE-1 did not change with 78% counting efficiency for [ I]. after liver injury induced by carbon tetrachloride and bile duct ligation in rats (Hocher et al. 2011). However, neither cellular sources nor expression levels of ECE-1 or Cloning of cDNA probes and multiprobe its isoforms were studied in vivo. Therefore, we investi- RNase protection assay gated the temporospatial expression patterns of ECE-1 at the RNA level by in situ hybridization and isoform- The cDNA for rat endothelin converting enzyme-1 (ECE- specific RNase protection assays and related these to 1) covering coding positions 1–441 bp was prepared ECE-1 activity in acute and chronic liver fibrogenesis. from rat liver tissue by RT–PCR amplification according to the published sequence (Shimada et al. 1994) (GenBank accession number: D 29683, sense primer: Material and methods TGCGGTCGGAGCGTAGAGCT, antisense primer: ACCA- CAGGCGTAGCTGAAGAA), verified by sequence analysis Animals and experimental design and cloned into pZErO-1 (Invitrogen, San Diego, CA, All animal experiments were conducted in accordance USA). The probe was designed to detect the three with German state laws approving and governing the different ECE-1 isoforms (ECE-1a, b, and c). The protected use of experimental animals. Ten week old female sequences were as follows: ECE-1a, 260 bp; ECE-1b, Wistar rats (Schoenwalde, Germany., approx. 250 g) 340 bp; ECE-1c, 439 bp (Figure 1). Internal standardiz- were maintained under 12-hour light–dark cycles and ation was conducted using a 102 bp GAPDH probe at 23 ± 2°C with a humidity of 60 ± 10%. During the (from position 335 to 437, M17701). Preparation of experiment, the animals received pellet chow diet total RNA and RNase protection assays were performed freely (Ssniff, Germany). The rats were used for induction as described previously (Cho et al. 2000). Briefly, after of secondary biliary fibrosis by complete bile duct occlu- extraction of RNA using acid guanidinium thiocyanate- sion (BDO) and scission following retrograde injection of phenol–chloroform, the integrity of all samples was Ethibloc (sodium amidotrizate) as previously described documented by visualization of 18S and 28S ribosomal (Cho et al. 2000; Karsdal et al. 2016; Santos-Laso et al. bands after electrophoresis. Radiolabeled cRNA was pro- 2017). Animals were sacrificed after 6 weeks when duced by in vitro transcription with T7 polymerase tissue hepatic collagen is increased 8–12 fold served as (Ambion, Austin, TX, USA) using [α- P] UTP (800 Ci/ controls. Acute fibrogenesis was induced in 7 week old mmol, 10 mCi/mL; NEN, Boston, MA, USA), followed by 5 32 male rats (weight approx. 125 g) by a single dose of incubation with 10 cpm of P-labeled cRNA, denatura- carbon tetrachloride (CCl ) (Sigma, St. Louis, MO, USA) tion at 95°C and overnight hybridization at 42°C. Follow- injected intraperitoneally at 1.25 ml/kg body weight ing hybridization, RNase A and T1 (Ambion, Austin, TX, and sacrificed in groups of 6, 12, 24, 48, and 72 h animals. USA) digestion of unbound labels and unprotected 172 T.-J. CHO ET AL. mRNA was conducted. The protected RNA-RNA hybrids concentration as measured by the Micro BCA assay kit were denatured and separated by electrophoresis (Pearce, Rockford, IL, USA). through a 5% polyacrylamide/8M urea sequencing gel, after which the gel was exposed to an X-ray film for Statistics 48 h. Autoradiograms were analyzed with the public domain NIH Image program. Signals for ECE-1 isoform Statistical analysis was performed using analysis of var- mRNAs were normalized to the signal for GAPDH iance, Duncan’s multiple range test for differences mRNA and expressed as relative abundance (arbitrary between groups, and Pearson’s correlation coefficient. units). The differences in relative abundance of mRNAs were analyzed by the Kruskal–Wallis test. Results Tissue endothelin-1 and endothelin receptor Endothelin-converting enzyme activity protein tissue levels Endothelin-converting enzyme activity was measured by Hepatic levels of ET-1, ET R and ET R were increased 7.2-, A B the production rate of endothelin-1 from big-endothelin 7.35- and 4.9-fold, respectively, in BDO rats compared to with minor modifications of a previously reported the normal control group (p < 0.001), indicating a strong method (Mitani et al. 2000). Briefly, membrane-bound activation of the endothelin system in chronic liver fibro- proteins were enriched by homogenization of 100 mg genesis (Figure 2). liver tissue in 1 ml 20 mM Tris-HCl, pH 7.4, containing 5 mM MgCl , 20 µM pepstatin A, 20 µM leupeptin, and 50 µM p-amidinophenyl methanesulphonyl fluoride Patterns of ECE-1 mRNA expression in normal (homogenization buffer). The homogenates were then liver and in hepatic fibrogenesis centrifuged at 1,000 g and 4°C for 10 min to remove cell debris, followed by high-speed centrifugation of In situ hybridization with [ S]-labeled RNA probes was 200 µl of the supernatant at 100,000 g and 4°C for used to define the cellular source of ECE-1 expression. 45 min. The resultant pellets were solubilized in hom- In normal liver, ECE-1 transcript levels were homoge- ogenization buffer containing 0.5% (w/v) Triton X-100 neously distributed over hepatocytes. Some perisinu- and centrifuged again (100,000 g, 4°C for 60 min), after soidal nonparenchymal cells also expressed ECE-1 which the supernatant was transferred to fresh tubes. RNA at levels similar to hepatocytes. Slightly increased Next, 25 μL of the supernatant was diluted with 100 µL signals were found over endothelial cells of the portal assay buffer (20 mM Tris-HCl, pH 6.8, containing and terminal hepatic veins and arteries. Occasionally, 100 nM big endothelin-1, 0.1% (w/v) bovine serum bile duct epithelia showed low-level ECE-1 RNA albumin, 20 µM pepstatin A, 20 µM leupeptin) and incu- expression. bated for 2 h at 37°C. The reaction was stopped with Compared to normal liver cells, all hepatic cells dis- 125 µL 5 mM EDTA and the concentration of generated played increased ECE-1 transcript levels in biliary cirrho- ET-1 determined with the endothelin ELISA kit as sis. Hepatocytes as well as perisinusoidal cells were the described above. This was normalized to protein major locations of ECE-1 mRNA expression, whereas Figure 2. Upregulation of tissue endothelin-1 and endothelin A and B receptor levels in rats with secondary biliary cirrhosis. Note: BDO, bile duct occlusion; Sham, sham operation as a negative control. ETAR, endothelin A receptor; ETBR, endothelin B receptor. *, P < 0.05 vs. control. ANIMAL CELLS AND SYSTEMS 173 ECE-1 specific autoradiographic signals remained lower in bile duct cells and portal fibroblasts. At 24 h after injection of CCl , ECE-1 transcript levels increased over perisinusoidal as well as central/portal venular and arterial endothelial cells. Some of these cells were desmin positive, indicating they were acti- vated stellate cells or myofibroblasts. As in the BDO model of chronic fibrogenesis, ECE-1 RNA predominated in hepatocytes. Desmin-positive cells adjacent to peri- central areas of necrosis showed higher levels of ECE-1 mRNA than hepatocytes, whereas bile duct epithelia dis- played lower ECE-1 RNA levels compared to hepatocytes. Expression of ECE-1 isoform mRNAs in acute and chronic hepatic fibrogenesis To differentiate the expression patterns of the three ECE-1 isoform mRNAs (ECE-1a, -1b and -1c), an ECE-1 cDNA probe that allowed detection of the three isoforms during the RNase protection assay was generated. After 6 weeks of BDO as well as after a single dose of CCl , expression of the predominant ECE-1c isoform remained unchanged. Figure 3. Upregulation of endothelin converting enzyme-1 a and However, ECE-1a and -1b isoform mRNAs were increased b, but not c isoform mRNA in rats with secondary biliary cirrhosis. Note: Multiprobe-RNase protection assay. (A) Autography and (B) relative slightly by 1.3–1.4 fold in biliary fibrosis and 1.5–2.2 fold abundance of endothelin converting enzyme-1 a and -1 b isoform mRNAs. at 48 h after CCl -induced acute liver injury (p < 0.05), P, cRNA probes, T, negative control containing transfer RNA; Control, respectively (Figure 3). After CCl intoxication, both ECE- normal liver; BDO, BDO alone as positive control; *, P < 0.05 vs. control. 1a and -1b isoforms increased in a time-dependent manner, with the maximum occurring after 48 h (Figure 4). Figure 4. Dynamics of endothelin converting enzyme-1 isoform mRNAs expression in rats with acute carbon tetrachloride intoxication. Note: Multiprobe-RNase protection assay. (A) Autography and (B) relative abundance of endothelin converting enzyme-1 a and -1 b isoform mRNAs. P, cRNA probes, T, negative control containing transfer RNA; N, normal liver. 174 T.-J. CHO ET AL. ECE-1 activity in biliary fibrosis and after acute expression patterns of ECE-1 and its isoforms during CCl intoxication acute and chronic hepatic fibrogenesis. Because tissue levels of ET-1, ET R and ET R are upre- A B We measured the activity of ECE-1 to clarify whether the gulated during liver fibrogenesis while the ET-1 pro- increases in ECE-1a and -1b isoform mRNAs were cessor big-ET-1 remains unchanged (Figure 2), ECE-1 coupled with enhanced ECE-1 enzymatic activity, as should serve as the gatekeeper for enhanced ET reflected by increased in vivo generation of ET-1. In production. biliary fibrosis, ECE-1 activity increased 7-fold compared We found that ECE-activity increased by 1.3–1.4 fold in to the normal controls (p < 0.05) (Figure 5). After acute BDO and after acute (CCl4-induced) fibrogenesis. This CCl intoxication, ECE-1 activity (Figure 5(B)). was reflected by moderate, up to 1.3 and 1.4 fold increased expression of hepatic ECE-1a and -1b mRNA, respectively, whereas ECE-1c mRNA remained Discussion unchanged. Because parenchymal ECE-1 mRNA was con- The endothelin system plays an important role in vascular stitutive constitutive and that by endothelial as well as homeostasis and various pathophysiological processes, some desmin-positive (myofibroblastic) cells upregu- including liver diseases. Thus, it is activated in cardiovas- lated, it may be speculated that ECE-1a and -1b isoforms cular diseases (Kalk et al. 2011) and atherosclerosis are mainly produced by nonparenchymal cells and upre- (Huang 2009), pulmonary disease (Moody et al. 2017) gulated during fibrogenesis. and hepatic fibrosis (Cho et al. 2000). ECE-1, of which Our results are in accordance with those of previously there are at least four isoforms, is the key enzyme involved conducted studies. For example, tissue ECE activity is cor- in ET-activation and may play an important role in hepatic related with coronary artery disease (Nguyen et al. 2010), fibrogenesis and other diseases. Because little is known while ECE-1 activity was show to be upregulated during about ECE-1 expression in the liver, we investigated the buccal mucosal ulcer (Slomiany et al. 2000) and gastric ulcer (Slomiany and Slomiany 2005) in rats and accompanied by the induction of TNF-α and apoptosis. Furthermore, inhibition of ECE-1 attenuated athero- sclerosis (Grantham et al. 2000) and hypertension (Takeda et al. 2000). Summarizing those results indicates that the ET-system, especially ECE, might play a crucial role in the pathophysiology of tissue regeneration. Simi- larly, our data confirmed that ECE is of great importance to liver fibrogenesis. However, the results of the present study contradicted those of Shao et al., who showed that the ECE-1 mRNA level in hepatic stellate cells was reduced and ECE-1 protein content was increased in liver fibrosis (Nagata et al. 2005; Hocher et al. 2011). These differences likely occurred because of differences in the experimental model. Specifically, Shao et al. used freshly isolated hepatic stellate cells, whereas we used whole liver tissues. Because ECE-1 mRNA expression was widely distributed in not only HSC, but also hepato- cytes, perisinusoidal cells, and venular/arterial endo- thelial cells, the action of ECE-1 is not limited to HSC. Furthermore, the different expression patterns depend on ECE-1 isoforms. Overall, the results of this study indicate that modu- lation of ECE-1 isoform expression might play a key role in ET-system activation in liver fibrogenesis. Figure 5. Endothelin-converting enzyme-1 activity. Acknowledgments Note: Conversion of big ET-1 to ET-1 by ECE-1 in solubilized membrane frac- tions of rat liver tissues. (A) ECE-1 activity in acute liver injury induced by This research was supported by the Institute for Information & carbon tetrachloride and (B) in advanced liver fibrosis due to bile duct occlu- sion for 6 weeks by rat secondary biliary fibrogenesis. Communication Technology Promotion (IITP) through the ANIMAL CELLS AND SYSTEMS 175 National Research Foundation (NRF) funded by the South Martell M, Coll M, Ezkurdia N, Raurell I, Genesca J. 2010. Korean government (860-20180051). Physiopathology of splanchnic vasodilation in portal hyper- tension. World J Hepatol. 2:208–220. Mitani H, Takimoto M, Bandoh T, Kimura M. 2000. Increases of vascular endothelin-converting enzyme activity and Disclosure statement endothelin-1 level on atherosclerotic lesions in hyperlipi- No potential conflict of interest was reported by the authors. demic rabbits. Eur J Pharmacol. 387:313–319. Moody TW, Ramos-Alvarez I, Moreno P, Mantey SA, Ridnour L, Wink D, Jensen RT. 2017. Endothelin causes transactivation of the EGFR and HER2 in non-small cell lung cancer cells. Funding Peptides. 90:90–99. This work was supported by the National Research Foundation Muller L, Barret A, Etienne E, Meidan R, Valdenaire O, Corvol P, of Korea (NRF) grant funded by the Korea government (MSIT) Tougard C. 2003. Heterodimerization of endothelin-convert- (No. 860-20180051). ing enzyme-1 isoforms regulates the subcellular distribution of this metalloprotease. J Biol Chem. 278:545–555. Nagata T, Kudo H, Nishino T, Doi Y, Itoh H, Fujimoto S. 2005. Increased immunoreactivities against endothelin-converting References enzyme-1 and monocyte chemotactic protein-1 in hepatic Barman SA. 2007. Vasoconstrictor effect of endothelin-1 on stellate cells of rat fibrous liver induced by thioacetamide. hypertensive pulmonary arterial smooth muscle involves Med Mol Morphol. 38:161–172. Rho-kinase and protein kinase C. Am J Physiol Lung Cell Nguyen A, Thorin-Trescases N, Thorin E. 2010. Working under Mol Physiol. 293:L472–L479. pressure: coronary arteries and the endothelin system. Am Cho JJ, Hocher B, Herbst H, Jia JD, Ruehl M, Hahn EG, Riecken J Physiol Regul Integr Comp Physiol. 298:R1188–R1194. EO, Schuppan D. 2000. An oral endothelin-A receptor antag- Orzechowski HD, Richter CM, Funke-Kaiser H, Kröger B, Schmidt onist blocks collagen synthesis and deposition in advanced M, Menzel S, Bohnemeier H, Paul M. 1997. Evidence of rat liver fibrosis. Gastroenterology. 118:1169–1178. alternative promoters directing isoform-specific expression Grantham JA, Schirger JA, Wennberg PW, Sandberg S, Heublein of human endothelin-converting enzyme-1 mRNA in cul- DM, Subkowski T, Burnett JCJ. 2000. Modulation of function- tured endothelial cells. J Mol Med (Berl). 75:512–521. ally active endothelin-converting enzyme by chronic neutral Rodriguez-Pascual F, Busnadiego O, Gonzalez-Santamaria J. endopeptidase inhibition in experimental atherosclerosis. 2014. The profibrotic role of endothelin-1: is the door still Circulation. 101:1976–1981. open for the treatment of fibrotic diseases? Life Sci. Hocher B, Heiden S, von Websky K, Rahnenführe J, Kalk P, Pfab 118:156–164. T. 2011. Dual endothelin-converting enzyme/neutral endo- Santos-Laso A, Munoz-Garrido P, Felipe-Agirre M, Bujanda L, peptidase blockade in rats with D-galactosamine-induced Banales JM, Perugorria MJ. 2017. New advances in the mol- liver failure. Eur J Med Res. 16:275–279. ecular mechanisms driving biliary fibrosis and emerging mol- Huang PL. 2009. eNOS, metabolic syndrome and cardiovascular ecular targets. Curr Drug Targets. 18:908–920. disease. Trends Endocrinol Metab. 20:295–302. Schweizer A, Valdenaire O, Nelböck P, Deuschle U, Dumas Milne Kalk P, Sharkovska Y, Kashina E, von Websky K, Relle K, Pfab T, Alter Edwards JB, Stumpf JG, Löffler BM. 1997. Human endothelin- M, Guillaume P, Provost D, Hoffmann K, et al. 2011. Endothelin- converting enzyme (ECE-1): three isoforms with distinct sub- converting enzyme/neutral endopeptidase inhibitor SLV338 cellular localizations. Biochem J. 328:871–877. prevents hypertensive cardiac remodeling in a blood Shimada K, Takahashi M, Tanzawa K. 1994. Cloning and func- pressure-independent manner. Hypertension. 57:755–763. tional expression of endothelin-converting enzyme from Karsdal MA, Genovese F, Madsen EA, Manon-Jensen T, rat endothelial cells. J Biol Chem. 269:18275–18278. Schuppan D. 2016. Collagen and tissue turnover as a func- Slomiany BL, Piotrowski J, Slomiany A. 2000. Suppression of tion of age: implications for fibrosis. J Hepatol. 64:103–109. endothelin-converting enzyme-1 during buccal mucosal Kocyigit I, Eroglu E, Kaynar AS, Kocer D, Kargi S, Zararsiz G, ulcer healing: effect of chronic alcohol ingestion. Biochem Bayramov R, Imamoglu H, Sipahioglu MH, Tokgoz B, et al. Biophys Res Commun. 271:318–322. 2018. The association of endothelin-1 levels with renal survi- Slomiany BL, Slomiany A. 2005. Endothelin-1-dependent up- val in polycystic kidney disease patients. J Nephrol. 32:83–91. regulation of leptin production in gastric mucosal injury by Kohan DE, Rossi NF, Inscho EW, Pollock DM. 2011. Regulation of indomethacin. Inflammopharmacology. 13:455–466. blood pressure and salt homeostasis by endothelin. Physiol Takeda Y, Inaba S, Furukawa K, Fujimura A, Miyamori I, Mabuchi Rev. 91:1–77. H. 2000.Effects of chronic neutral endopeptidase inhibition Ling L, Kuc RE, Maguire JJ, Davie NJ, Webb DJ, Gibbs P, in rats with cyclosporine-induced hypertension. J Alexander GJ, Davenport AP. 2012. Comparison of endothe- Hypertens. 18:927–933. lin receptors in normal versus cirrhotic human liver and in Valdenaire O, Rohrbacher E, Mattei MG. 1995. Organization of the liver from endothelial cell-specific ETB knockout mice. the gene encoding the human endothelin-converting Life Sci. 91:716–722. enzyme (ECE-1). J Biol Chem. 270:29794–29798.
Journal
Animal Cells and Systems
– Taylor & Francis
Published: May 4, 2019
Keywords: Endothelin-converting enzyme-1; endothelin-1; hepatic fibrogenesis; endothelin receptor
