DeepDyve requires Javascript to function. Please enable Javascript on your browser to continue.
GABAergic neuronal differentiation induced by brain-derived neurotrophic factor in human mesenchymal stem cells GABAergic neuronal differentiation induced by brain-derived neurotrophic factor in human...
Yu, Ji Hea; Kim, Myung-Sun; Lee, Min-Young; Lee, Ji Yong; Seo, Jung Hwa; Cho, Sung-Rae
2014-01-02 00:00:00
NEUROBIOLOGY & PHYSIOLOGY Animal Cells and Systems, 2014 Vol. 18, No. 1, 17–24, http://dx.doi.org/10.1080/19768354.2013.877076 GABAergic neuronal differentiation induced by brain-derived neurotrophic factor in human mesenchymal stem cells a,b a,c a a,d a,e a,b,e,f,g* Ji Hea Yu , Myung-Sun Kim , Min-Young Lee , Ji Yong Lee , Jung Hwa Seo and Sung-Rae Cho a b Department and Research Institute of Rehabilitation Medicine, Yonsei University College of Medicine, Seoul, Korea; Brain Korea 21 PLUS Project for Medical Science, Yonsei University, Seoul, Korea; Graduate School of Biomedical Science and Engineering/College d e of Medicine, Hanyang University, Seoul, Korea; Department of Anatomy, Yonsei Wonju College of Medicine, Wonju, Korea; Graduate Program of Nano Science and Technology, Yonsei University College of Medicine, Seoul, Korea; Yonsei Stem Cell Research Center, Avison Biomedical Research Center, Seoul, Korea; Rehabilitation Institute of Neuromuscular Disease, Yonsei University College of Medicine, Seoul, Korea (Received 1 July 2013; received in revised form 2 December 2013; accepted 13 December 2013) Mesenchymal stem cells (MSCs) have been derived from different sources including adipose tissue (AT), bone marrow (BM), and umbilical cord blood (UCB). We investigated that human MSCs may differentiate into neurons that produce γ-aminobutyric acid ((GABA)ergic neurons) in response to brain-derived neurotrophic factor (BDNF). This potential for GABAergic neuronal differentiation was also evaluated in MSCs derived from different sources of AT, BM, and UCB. For this purpose, the AT-, BM-, and UCB-MSCs were plated onto poly-D-lysine/laminin with BDNF, and were compared with control MSCs cultured without BDNF. To compare various neuronal differentiation potential among BM-, UCB-, and AT- MSCs, reverse transcription polymerase chain reaction was performed with nestin, a neural stem cell marker, ChAT, a cholinergic neuronal marker, TH, a dopaminergic neuronal marker, and GAD67, a GABAergic neuronal marker. Immunocytochemistry was also assessed as the expression of βIII-tubulin and GABA. As a result, the BDNF-treated groups of BM-, UCB-, and AT-MSCs expressed nestin at higher levels than control MSCs. In addition, the BDNF-treated groups of BM- and UCB-MSCs expressed GAD67 at higher levels than control MSCs, whereas GAD67 was not increased in the BDNF-treated group of AT-MSCs. In immunocytochemistry, exposure to BDNF promoted GABAergic neuronal + + differentiation, as demonstrated by the increased percentages of GABA /GABA+ /4′,6-diamidino-2-phenylindole (DAPI) cells compared with the control cultures of AT-, BM-, and UCB-MSCs. In particular, after the BDNF-induced GABAergic + + neuronal differentiation, GABA /DAPI cells (%) were significantly increased in BM-MSCs compared with the other groups. In conclusion, BM-MSC is the most ideal cell source for human MSCs into GABAergic neuronal differentiation. Keywords: mesenchymal stem cells; GABAergic neuron; brain-derived neurotrophic factor Introduction than BM-MSCs for neuronal differentiation in vitro or after coculture with Schwann cells (Kang et al. 2004; Krampera Mesenchymal stem cells (MSCs) have been derived from et al. 2007). BM-derived MSCs, in particular, differentiate several different sources including adipose tissue (AT), into neuroectoderm (Sanchez-Ramos et al. 2000; Grove bone marrow (BM), and umbilical cord blood (UCB). They et al. 2004) and endoderm (Petersen et al. 1999; Jiang et al. may be propagated in vitro (Pittenger et al. 1999; Lidroos 2002), as well as mesoderm. Neuronal differentiation has et al. 2011; Huang et al. 2012). MSCs show significant been achieved with different experimental protocols using potential for clinical applications (Giordano et al. 2007), chemical agents, growth factors, or coculture with neural through their capacity to differentiate into cells of diverse cells. The chemical agents generally induce transient lineages, and trophic factors secreted by such cells might morphological changes with upregulation of several promote tissue regeneration (Caplan 2007; Greco et al. neural-lineage markers (Woodbury et al. 2000; Lu et al. 2007). MSCs derived from AT (AT-MSCs) present another 2004; Croft & Przyborski 2006). Growth factors promote alternative to BM-MSC, in their pluripotency and ability to more specific and persistent neural differentiation (Jiang differentiate into mesenchymal and nonmesenchymal lineages. AT-MSCs are readily accessible and proliferate et al. 2002; Dezawa et al. 2004; Egusa et al. 2005), while complete neuronal differentiation has been obtained only rapidly in vitro with a relatively low proportion of senescent cells. In addition, the number of cells obtained in liposuc- after coculture with astroglial or neuronal cells (Sanchez- Ramos et al. 2000; Jiang et al. 2003; Wislet-Gendebien tion aspirates maybe sufficient for some clinical uses without further manipulation (Kang et al. 2004). This et al. 2005). UCB-MSCs have the same potential to expand evidence suggests that AT-MSCs display greater potential and differentiate into neurons (Hou et al. 2003). Neural *Corresponding author. Email: srcho918@yuhs.ac © 2014 Korean Society for Integrative Biology 18 J.H. Yu et al. stem cell line derived from human UCB was also estab- 5% B27 supplement (Invitrogen-Gibco) and 50 ng/mL lished (Jurga et al. 2006). BDNF (Peprotech, Rocky Hill, NJ, USA). Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, strongly induces neuronal Reverse transcription polymerase chain reaction differentiation (Canals et al. 2001; Silva et al. 2009) and (RT-PCR) displays potent neuroprotective activities on neurons that produce γ-aminobutyric acid (GABAergic neurons) Total RNA was extracted using Trizol (Invitrogen-Gibco). (Peterse′n et al. 2001; Silva et al. 2009). Neurosphere- For the synthesis of single-stranded cDNA from pure total derived cells exposed to BDNF differentiate largely into RNA, the Reverse Transcription System Kit (Fermentes, MD, USA) was used. For reverse transcription, the follow- GABAergic neurons. An increase in endogenous GABA ing reaction-specific primers were used: nestin, forward and a decrease in glutamate levels on exposure to BDNF primer 5′-GCTCCTCTCTCTCTGCTCCA−3′ and reverse suggest the activation of glutamic acid decarboxylase primer 5-’CACCGGTTCTCCATCCTTA−3′, product size (GAD), the enzyme that converts glutamate into GABA 229 bp; ChAT, forward 5′-GGAGGCGTGGAGCTCAGC- (Silva et al. 2009). Nevertheless, few studies have tested the GACACC−3′ and reverse 5′-CGGGGAGCTCGCTGAC capacity of MSCs derived from different sources for GGAGTCTG−3′, 256 bp; TH, forward 5′-GTTCGAC GABAergic differentiation on exposure to BDNF. CCTGACCTGGACT−3′ and reverse 5′-CCAGCTGG Therefore, we hypothesized that MSCs could differ- GGGATATTGTCT−3′, 273 bp; GAD25, a shorted var‐ entiate into the GABAergic neurons in the presence of iant of GAD67 as an alternative splicing form in human BDNF. AT-, BM-, and UCB-MSCs were cultivated under nonneural tissues (Chessler & Lernmark 2000), forward 5′- established conditions, and the MSCs from these different CCTGGTTGACTGCAGAGACA− 3′ and reverse 5′- sources were also compared for their potential to differ- TGGAAACCATGTGTGCAGTT−3′, 243 bp; glyceralde- entiate toward GABAergic neuronal properties. We found hyde 3-phosphate dehydrogenase (GAPDH), forward 5′- that BM-MSCs characteristically underwent GABAergic ACAGTCAGCCGCATCTTCTT− 3′ and reverse 5′- neuronal differentiation in response to BDNF. TTGATTTTGGAGGGATCTCG− 3′, 312 bp. Materials and methods Quantitative real-time PCR (qRT-PCR) Culture of MSCs To provide quantitative information regarding gene expres- Human AT-MSCs bought from Invitrogen (catalog no.: sion of GAD67, the qRT-PCR was performed in triplicate 510070, lot no.: 1212) and BM-, UCB-MSCs were on a Light Cycler 480 (Roche Applied Science, Mannheim, obtained from Yonsei Cell Therapy Center, Severance Germany) using the Light Cycler 480 SYBR Green master hospital (lot nos.: B100420-06 and CB110331-02). mix (Roche Applied Science, Mannheim, Germany), and Human AT-, BM-, and UCB-MSCs were seeded at 1−5 the thermocycler conditions were as follows: amplifications 4 2 ×10 cells/cm in T25 or T75 culture flasks in low- were performed starting with a 300-s template preincuba- glucose Dulbecco’s Modified Eagle Medium (DMEM; tion step at 95°C, followed by 45 cycles at 95°C for 10 s, Invitrogen-Gibco, Rockville, MD, USA) containing 10% 53°C for 10 s, 72°C for 10 s, and 82°C for 1 s. The melting fetal bovine serum (FBS; Invitrogen-Gibco) and 100 U/ml curve analysis began at 95°C for 5 s, followed by 1 minute penicillin/streptomycin (Invitrogen-Gibco) in a humidified at 60°C. The specificity of the produced amplification 5% CO atmosphere at 37 C. The media were replaced at product was confirmed by the examination of a melting three day interval. Adherent MSCs were subcultured when curve analysis and showed a distinct single sharp peak with they reached 70–80% confluence. the expected Tm for all samples. A distinct single peak indicates that a single DNA sequence was amplified during qRT-PCR. GABAergic neuronal differentiation MSCs cultured six-well plates were prepared with poly- Immunocytochemistry D-lysine (PDL; Sigma-Aldrich, St. Louis, MO, USA) and laminin (LN; Sigma-Aldrich). The plates were initially MSCs were fixed and permeabilized with 4% paraformal- coated with 50 µg/ml PDL solution for 16 hr, washed twice dehyde and blocked with 0.1% Triton X−100, 10% goat with water, and air-dried in a sterile hood. LN (5 µg/ml) was serum in phosphate buffered saline (PBS). Fixed cells were then added for 1–2 hr. MSCs were trypsinized and incubated with primary antibodies overnight at 4°C. To subcultured in plates precoated with PDL/LN. After adher- quantify the percentage of human MSCs that differentiated ence for 24 hr in DMEM containing 10% FBS and 100 U/ to GABAergic neurons, cultures in 35-mm dishes coated ml penicillin-streptomycin, the medium was replaced with with PDL/LN were immunostained for βIII-tubulin (Cov- neurobasal medium (NB medium; Invitrogen-Gibco) with ance, Emeryville, CA, USA) and GABA (Sigma-Aldrich), Animal Cells and Systems 19 NO PDL/LN PDL/LN PDL/LN+BDNF BC AT DE F BM G HI UCB Figure 1. Morphological changes in human MSCs during GABAergic neuronal differentiation. (A) Morphology of AT-MSCs in basal condition without PDL/LN and BDNF. (B) Morphology of AT-MSCs plated onto PDL/LN without BDNF. (C) Morphology of AT-MSCs plated onto PDL/LN with BDNF. (D) Morphology of BM-MSCs in basal condition without PDL/LN and BDNF. (E) Morphology of BM-MSCs plated onto PDL/LN without BDNF. (F) Morphology of BM-MSCs plated onto PDL/LN with BDNF. (G) Morphology of UCB-MSCs in basal condition without PDL/LN and BDNF. (H) Morphology of UCB-MSCs plated onto PDL/LN without BDNF. (I) Morphology of UCB-MSCs plated onto PDL/LN with BDNF. AT, adipose tissue; BM, bone marrow; UCB, umbilical cord blood; PDL, poly-D-lysine; LN, laminin; BDNF, brain-derived neurotrophic factor, Scale bar = 200 µm. and counterstained with 4′,6-diamidino-2-phenylindole BDNF was performed in BM-, UCB-, and AT-MSCs using (DAPI) (Sigma-Aldrich) to identify cell nuclei. The βIII- t-test and analysis of variance (ANOVA) with post hoc tubulin- and GABA-positive cells were counted in ran- Bonferroni comparison. A P-value <0.05 was considered domly selected fields (n = 10 each group). Differentiation statistically significant. potentials into neurons and GABAergic neurons were quantified from confocal images as the percentage of + + + Results βIII-tubulin and GABA cells in the DAPI cells (%). Morphological changes in human MSCs during GABAergic neuronal differentiation Statistical analysis We compared the capacities of BM-, UCB-, and AT-MSCs + + The numbers of βIII-tubulin and GABA cells were plated onto PDL/LN to undergo neuronal differentiation in calculated as the percentage of total cells identified with the presence of BDNF. All cells were cultured in NB DAPI. Results shown in the bar graphs are the mean ± SE of medium supplemented with B27 (1 × 10 cells per 35-mm at least 10 independent experiments. Statistical analysis of dish) prior to induction with BDNF. Following induction, the potential for GABAergic neuronal differentiation with cell morphologies were monitored. The human MSCs in 20 J.H. Yu et al. Figure 2. GABAergic neuronal differentiation changes of gene expression in human MSCs. (A) After seven days of GABAergic neuronal induction with BDNF, expression of nestin, a neural stem cell marker, ChAT, a cholinergic neuronal marker, TH, dopaminergic neuronal marker and GAD67, a GABAergic neuronal marker were analyzed using RT-PCR. Lanes 1, 3, and 5 with BDNF treatment; Lanes 2, 4, and 6 without BDNF treatment. (B–D) The qRT-PCR after treatment with BDNF in AT-MSCs (B), BM-MSCs (C), and UCB- MSCs (D). The qRT-PCR confirmed that GAD67 characteristically increased after treatment with BDNF in BM-MSCs. AT, adipose tissue; BM, bone marrow; UCB, umbilical cord blood; BDNF, brain-derived neurotrophic factor. the presence of BDNF assumed neuron-like morphology, control groups (Figure 2A). In addition, BM- and UCB- whereas control MSCs without BDNF retained the flat- MSCs showed increased ChAT expression compared to like morphology. In other words, MSCs cultured with control MSCs after treatment with BDNF, while BDNF- BDNF acquired thinner and longer shapes with branched treated AT-MSCs not increased ChAT compared to control processes after seven days of GABAergic induction in NB MSCs. However, a dopaminergic neuronal marker TH was medium, while control MSCs cultured without BDNF not increased in any group among AT-, BM-, and UCB- maintained the original flat morphology with only short MSCs after treatment with BDNF. On the other hand, a extensions (Figure 1). However, the cell counts were not GABAergic neuronal marker, GAD67 expression was significantly different between the BDNF-treated group significantly increased in BM-MSCs and UCB-MSCs that and control group in AT-, BM-, and UCB-MSCs. underwent BDNF-treated neuronal differentiation, whereas AT-MSCs did not increase GAD67 expression after treat- ment with BDNF (Figure 2A). Furthermore, when real-time Changes in gene expression in human MSCs after PCR was performed to analyze quantitative GAD67 GABAergic neuronal differentiation expression, the fold change of the BM-MSCs characterist- Changes in RNA expression after BDNF treatment in ically increased after treatment with BDNF (3.88 ± 0.4; human MSCs were shown by RT-PCR analysis. To compare Figure 2C). various neuronal differentiation potential among BM-, UCB-, and AT-MSCs, RT-PCR was performed with nestin, Immunocytochemistry of human MSCs after GABAergic a neural stem cell marker; ChAT, a cholinergic neuronal neuronal differentiation marker; TH, a dopaminergic neuronal marker; and GAD67, a GABAergic neuronal marker. Differentiations into neurons and GABAergic neurons were All BDNF-treated groups of AT-, BM-, and UCB- also assessed as the expression of βIII-tubulin, a neuronal MSCs showed higher levels of nestin expression than marker, and GABA, a marker of GABAergic neuron using AT- MSC BM- MSC UCB- MSC Nestin ChAT TH GAD67 GAPDH BDNF -+ -+ - + C D 5 5 5 4 4 4 3 3 3 2 2 1 1 1 0 0 0 AT-Control AT-BDNF BM-Control BM-BDNF UCB-Control UCB-BDNF Relative expression of GAD67 (fold change) Relative expression of GAD67 (fold change) Relative expression of GAD67 (fold change) Animal Cells and Systems 21 Control BDNF AB DAPI βΙΙΙ βΙΙΙ-tubulin AT GABA MERGE D E DAPI βΙΙΙ βΙΙΙ-tubulin BM GABA MERGE G H DAPI β βΙΙΙ ΙΙΙ-tubulin UCB GABA MERGE Figure 3. Immunocytochemistry in human MSCs after GABAergic neuronal differentiation. Immunocytochemistry of AT-, BM-, and UCB-MSCs after culture on PLD/LN with BDNF with immunostaining for βIII-tubulin (green), a neuronal marker, and GABA (red), a GABAergic neuronal marker. Blue color indicates DAPI staining. (A) Control AT-MSCs (B, C) BDNF-treated AT-MSCs (D) Control BM-MSCs (E, F) BDNF-treated BM-MSCs (G) Control UCB-MSCs (H, I) BDNF-treated UCB-MSCs. Scale bar (A), (B), (D), (E), (G), (H) = 100 µm, (C), (F), (I) = 50 µm. AT, adipose tissue; BM, bone marrow; UCB, umbilical cord blood; BDNF, brain-derived neurotrophic factor. + + immunocytochemistry. After seven days of culture in percentages of βIII-tubulin cells among DAPI cells conditions that promoted GABAergic neuronal induction, were not characteristically changed in the BDNF-treated the BDNF-treated MSCs exhibited the coexpressing cells groups (75.9 ± 2.7%, 94.7 ± 1.8%, and 85.8 ± 6.2% in with βIII-tubulin (green), GABA(red), and DAPI (blue; AT-, BM-, and UCB-MSCs, respectively) compared to + + + Figure 3). The βIII-tubulin , GABA , and DAPI cells control groups (96.77 ± 1.1%, 85.9 ± 2.7%, and 92.0 ± were respectively evaluated in the unit area of the confocal 2.3% in AT-, BM-, and UCB –MSCs, respectively; Figure images (1.646 mm ) in all the groups (n = 10 each). The 4A). On the other hand, exposure to BDNF promoted + + + percentages of βIII-tubulin or GABA cells among DAPI GABAergic neuronal differentiation, as demonstrated by + + cells (%) were then calculated. the increased percentages of GABA /DAPI cells com- As a result, the BDNF-treated groups of AT-, BM-, pared with the control cultures of AT-MSCs (9.7 ± 1.6% and UCB-MSCs increased GABA cells among DAPI vs. 5.3 ± 1.1%, t = 2.342, p = 0.031), BM-MSCs (21.5 ± cells (%) compared to control MSCs, whereas the BM- 4.2% vs. 8.4 ± 1.8%, t = 2.980, p = 0.011), and UCB- MSCs alone responded to the BDNF treatment, showing MSCs (7.0 ± 1.6% vs. 1.8 ± 1.1%, t = 2.893, p = 0.010; the increase of βIII-tubulin cells among DAPI cells (%) Figure 4B). In particular, after the BDNF-induced + + compared to control MSCs (Figure 4). Namely, the GABAergic neuronal differentiation, GABA /DAPI cells 22 J.H. Yu et al. Contol Contol 2 2 A (/mm ) (/mm ) BDNF BDNF 0 0 AT BM UCB AT BM UCB Figure 4. Analysis of GABAergic neuronal differentiation in the BDNF-treated MSCs. After seven days of GABAergic neuronal induction, the numbers of cells immunostained for DAPI, βIII-tubulin, and GABA were counted. (A) The percentages of βIII-tubulin cells among DAPI cells in human AT-, BM-, and UCB-MSCs. (B) The percentages of GABA+ cells among DAPI+ cells in human AT-, BM-, and UCB-MSCs. The results are expressed as the mean ± SE of cell numbers from 10 microscope fields in 10 independent culture dishes. Note: *P < 0.05 compared with control MSCs (BDNF treatment vs. control). P < 0.05 compared with the other groups (BDNF-treated BM-MSCs vs. the other groups). AT, adipose tissue; BM, bone marrow; UCB, umbilical cord blood; BDNF, brain-derived neurotrophic factor. (%) were significantly increased in BM-MSCs compared BDNF abundantly expressed in the central nervous with the other groups of AT-MSCs and UCB-MSCs (F = system (Lewin & Barde 1996) plays a crucial role in 10.414, p < 0.001 by ANOVA with post hoc Bonferroni activity-dependent changes in synaptic strength and net- comparison; Figure 4B). work refinement (Yamada et al. 2002). BDNF and the BDNF receptor, TrkB, are found in the striatum (Merlio et al. 1992; Altar et al. 1994; Altar et al. 1997). The BDNF Discussion protein in the adult rodent striatum is consistent with its This study compared the capacity of different sources from known actions on striatal neurons. Infusion of BDNF into human MSCs to differentiate toward a GABAergic neur- the adult rat striatum altered the expression of GABA onal phenotype. For the present study, we selected MSCs synthetic enzyme, GAD, and induced behavioral improve- from BM, UCB, and AT that have widely been used as three ment (Lindsay et al. 1994; Lewin & Barde 1996; Altar et al. possible sources of MSCs. For example, BM has served as 1997). In cell culture, BDNF increased the survival of the main source for isolation of multipotent MSCs, but the striatal GABA neurons and promoted dendritic branching harvest of BM is an invasive procedure (Rao & Mattson (Mizuno et al. 1994; Ventimiglia et al. 1995). BDNF also 2001; Stenderup et al. 2003). As alternative sources, AT promoted GABAergic maturation, facilitated GABA may be obtained by a minimally invasive method in larger release, upregulated the expression of GAD and GABA quantities than BM (Kern et al. 2006), and contains stem receptors, and enlarged the soma of GABAergic neurons cells similar to BM-MSCs (Zuk et al. 2002). UCB may also (Yamada et al. 2002). be obtained without harm. However, controversy still exists The noteworthy finding of this study was that human concerning the quality as a source of multipotent MSCs for MSCs from three different sources such as AT, BM, and neurological diseases (Lee et al. 2004). UCB differentiated toward a GABAergic neuronal pheno- A recent review presumed that immunophenotypic type in the presence of BDNF. Analysis of mRNA differences between BM-MSCs and AT-MSCs may con- expression, immunocytochemical staining of GABAergic tribute to the differences in responsiveness to growth neuronal markers, and the percentages of differentiated factors and biomaterial scaffolds (Marius et al. 2012). The GABAergic neurons support this finding. Particularly, after presence or absence of serum in the culture medium may GABAergic neuronal induction with BDNF, GABA / also influence differentiation potential of MSCs, even with DAPI cells (%) were significantly increased in BM- serum from the same species (Lidroos et al. 2011). Other MSCs. Taken together, we suggest that BM provides the observations suggest that difference between differenti- best source available for human MSCs with a higher ation efficiencies of previous studies reflects the hetero- potential for GABAergic neuronal differentiation, although geneity of MSC populations (Ho et al. 2008; Mareddy UCB and AT provide suitable alternatives. Functional et al. 2009; Rada et al. 2011) and the distinctive studies are needed to evaluate possible clinical applications differentiation potentials with various culture protocols selected for MSC subpopulations (Ho et al. 2008; of BDNF-induced GABAergic neuronal differentiation in Pevsner-Fischer et al. 2011; Rada et al. 2011). human MSCs. + + βΙΙΙ βΙΙΙ-tubulin /DAPI cells (%) + + GABA /DAPI cells (%) Animal Cells and Systems 23 et al. 2002. Pluripotency of mesenchymal stem cell derived Acknowledgments from adult marrow. Nature. 418:41–49. This study was supported by grants from the National Research Jurga M, Markiewicz I, Sarnowska A, Habich A, Kozlowska H, Foundation [NRF-2010-0020408] and the Stem Cell Research Lukomska B, Buzanska L, Domanska-Janik K. 2006. Neuro- Center of the 21st Century Frontier Research Program (SC-4160) genic potential of human umbilical cord blood: neural-like funded by the Ministry of Education, Science and Technology, stem cells depend on previous long-term culture conditions. J Republic of Korea. Neurosci Res. 83:627–637. Kang SK, Putnam LA, Ylostalo J, Popescu IR, Dufour J, Belousov A, Bunnell BA. 2004. Neurogenesis of rhesus adipose stromal References cells. J Cell Sci. 117:4289–4299. Altar CA, Cai N, Bliven T, Juhasz M, Conner JM, Acheson AL, Kern S, Eichler H, Stoeve J, Klüter H, Bieback K. 2006. Lindsay RM, Wiegand SJ. 1997. Anterograde transport of Comparative analysis of mesenchymal stem cells from bone brain-derived neurotrophic factor and its role in the brain. marrow, umbilical cord blood or adipose tissue. Stem Cells. Nature. 389:856–860. 24:1294–1301. Altar CA, Siuciak JA, Wright P, Ip NY, Lindsay RM, Wiegand SJ. Krampera M, Marconi S, Pasini A, Galiè M, Rigotti G, Mosna F, 1994. In situ hybridization of trkB and trkC receptor mRNA in Tinelli M, Lovato L, Anghileri E, Andreini A, et al. 2007. rat forebrain and association with high-affinity binding of Induction of neural-like differentiation in human mesenchy- (125I) NT-3, (125I) BDNF and (125I) NT-4/5. Eur J Neurosci. mal stem cells derived from bone marrow, fat, spleen and 6:1389–1405. thymus. Bone. 40:382–390. Canals JM, Checa N, Marco S, Akerud P, Michels A, Perez- Lee OK, Kuo TK, Chen WM, Lee KD, Hsieh SL, Chen TH. Navarro E, Tolosa E, Arenas E, Alberch J. 2001. Expression 2004. Isolation of multipotentmesenchymal stem cells from of brain-derived neurotrophic factor in cortical neurons is umbilical cord blood. Blood. 103:1669–1675. regulated by striatal target area. J Neurosci. 21:117–124. Lewin GR, Barde YA. 1996. Physiology of the neurotrophins. Caplan AI. 2007. Adult mesenchymal stem cells for tissue Ann Rev Neurosci. 19:289–317. engineering versus regenerative medicine. J Cell Physiol. Lidroos B, Suuronen R, Miettinen S. 2011. The potential of 213:341–347. adipose stem cells in regenerative medine. Stem cell Rev. Chessler SD, Lernmark A. 2000. Alternative splicing of GAD67 7:269–291. results in the synthesis of a third form of glutamic-acid Lindsay RM, Wiegand SJ, Altar CA, DiStefano PS. 1994. decarboxylase in human islets and other non-neural tissues. J Neurotrophic factors: from molecule to man. Trends Neurosci. Biol Chem. 275:5188–5192. 17:182–190. Croft AP, Przyborski SA. 2006. Formation of neurons by non- Lu P, Blesch A, Tuszynski MH. 2004. Induction of bone marrow neural adult stem cells: potential mechanism implicates an stem cells to neurons: differentiation, transdifferentiation, or artifact of growth in culture. Stem Cells. 24:1841–1851. artifact? J Neurosci Res. 77:174–191. Dezawa M, Kanno H, Hoshino M, Cho H, Matsumoto N, Mareddy S, Broadbent J, Crawford R, Xiao Y. 2009. Proteomic Itokazu Y, Tajima N, Yamada H, Sawada H, Ishikawa H, et profiling of distinct clonal populations of bone marrow al. 2004. Specific induction of neuronal cells from bone mesenchymal stem cells. J Cell Biochem. 106:776–786. marrow stromal cells and application for autologous trans- Marius S, Sowmya V, Adas D, Ondrej S, Jaroslav M. 2012. plantation. J Clin Invest. 113:1701–1710. Same or not the same? Comparison of adipose tissue-derived Egusa H, Schweizer FE, Wang CC, Matsuka Y, Nishimura J. 2005. versus bone marrow-derived mesenchymal stem and stromal Neuronal differentiation of bone marrow-derived stromal cells. Stem cell Dev. 21:2724–2752. stem cells involves suppression of discordant phenotypes Merlio JP, Ernfors P, Jaber M, Persson H. 1992.Molecular through gene silencing. J Biol Chem. 280:23691–23697. cloning of rat trkC and distribution of cells expressing Giordano A, Galderisi U, Marino IR. 2007.From the laboratory messenger RNAs for members of the Trk family in the rat bench to the patient’s bedside: an update on clinical trials central nervous system. Neuroscience. 51:513–532. with mesenchymal stem cells. J Cell Physiol. 211:27–35. Mizuno K, Carnahan J, Nawa H. 1994. Brain-derived neuro- Greco SJ, Zhou C, Ye JH, Rameshwar P. 2007. An interdisciplin- trophic factor promotes differentiation of striatal GABAergic ary approach and characterization of neuronal cells transdif- neurons. Dev Biol. 165:243–256. ferentiated from human mesenchymal stem cells. Stem Cells Petersen BE, Bowen WC, Patrene KD, Mars WM, Sullivan AK, Dev. 16:811–826. Murase N, Boggs SS, Greenberger JS, Goff JP. 1999. Bone Grove JE, Bruscia E, Krause DS. 2004. Plasticity of bone marrow as a potential source of hepatic oval cells. Science. marrow-derived stem cells. Stem Cells. 22:487–500. 284:1168–1170. Ho AD, Wagner W, Franke W. 2008. Heterogeneity of mesench- Peterse′n A, Larsen KE, Behr GG, Romero N, Przedborski S, ymal stromal cell preparations. Cytotherapy. 10:320–330. Brundin P, Sulzer D. 2001. Brain-derived neurotrophic factor Hou L, Cao H, Wang D, Wei G, Bai C, Zhang Y, Pei X. 2003. inhibits apoptosis and dopamine-induced free radical pro- Induction of umbilical cord blood mesenchymal stem cells duction in striatal neurons but does not prevent cell death. into neuron-like cells in vitro. Int J Hematol. 78:256–261. Brain Res Bull. 56:331–335. Huang Y, Parolini O, La Rocca G, Deng L. 2012.Umbilical cord Pevsner-Fischer M, Levin S, Zipori D. 2011. The origins of versus bone marrow-derived mesenchymal stromal cells. mesenchymal stromal cell heterogeneity. Stem Cell Rev. Stem Cells Dev. 21:2900–2903. 7:560–568. Jiang Y, Henderson D, Blackstad M, Chen A, Miller RF, Verfaillie Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, CM. 2003. Neuroectodermal differentiation from a mouse Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak multipotent adult progenitor cells. Proc Natl Acad Sci USA. DR. 1999. Multilineage potential of adult human mesench- 100:11854–11860. ymal stem cells. Science. 284:143–147. Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Rada T, Reiss RL, Gomes ME. 2011. Distinct stem cells Ortiz-Gonzalez XR, Reyes M, Lenvik T, Lund T, Blackstad M, subpopulation isolated from human adipose tissue exhibit 24 J.H. Yu et al. different chondrogenic and osteogenic differentiation poten- and morphological and biochemical differentiation of striatal tial. Stem cell Rev. 7:64–76. neurons in vitro. Eur J Neurosci. 7:213–222. Rao MS, Mattson MP. 2001. Stem cells and aging: expanding Wislet-Gendebien S, Hans G, Leprince P, Rigo JM, Moonen G, the possibilities. Mech Ageing Dev. 122:713–734. Rogister B. 2005. Plasticity of cultured mesenchymal stem Sanchez-Ramos J, Song S, Cardozo-Pelaez F, Hazzi C, Stedeford cells: switch from nestin-positive to excitable neuron-like T, Willing A, Freeman TB, Saporta S, Janssen W, Patel N, phenotype. Stem Cells. 23:392–402. et al. 2000. Adult bone marrow stromal cells differentiate Woodbury D, Schwarz EJ, Prockop DJ, Black IB. 2000. Adult into neural cells in vitro. Exp Neurol. 164:247–256. rat and human bone marrow stem cells differentiate into Silva A, Pereira J, Oliveira CR, Relvas JB, Rego AC. 2009. neurons. J Neurosci Res. 61:364–370. BDNF and extracellular matrix regulate differentiation of Yamada MK, Nakanishi K, Ohba S, Nakamura T, Ikegaya Y, mice neurosphere derived cells into a GABAergic neuronal Nishiyama N, Matsuki N. 2002. Brain derived neurotrophic phenotype. J Neurosci Res. 87:1986–1996. factor promotes the maturation of GABAergic mechanisms Stenderup K, Justesen J, Clausen C, Kassem M. 2003. Aging is in cultured hippocampal neurons. J Neurosci. 22:7580–7585. associated with decreased maximal life span and accelerated Zuk PA, Zuh M, Ashjian P, De Uqarte DA, Huang JI, Mizuno H, senescence of bone marrow stromal cells. Bone. 33:919–926. Alfonso ZC, Fraser JK, Benhaim P, Hedrick MH. 2002. Ventimiglia R, Mather PE, Jones BE, Lindsay RM. 1995. The Human adipose tissue is a source of multipotent stem cells. neurotrodhins BDNF, NT-3 and NT-4/5 promote survival Mol Biol Cell. 13:4279–4295.
http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png
Animal Cells and Systems
Taylor & Francis
http://www.deepdyve.com/lp/taylor-francis/gabaergic-neuronal-differentiation-induced-by-brain-derived-hOjQic5OGp
