DeepDyve requires Javascript to function. Please enable Javascript on your browser to continue.
High-fat-diet impaired mitochondrial function of cumulus cells but improved the efficiency of parthenogenetic embryonic quality in mice High-fat-diet impaired mitochondrial function of cumulus cells but improved the efficiency of...
Li, Jingjing; Wang, Shuang; Wang, Bo; Wei, Hao; Liu, Xin; Hao, Jun; Duan, Yanping; Hua, Jinlian; Zheng, Xiaomin; Feng, Xiuliang; Yan, Xingrong
2018-07-04 00:00:00
TRANSLATIONAL MEDICINE ANIMAL CELLS AND SYSTEMS 2018, VOL. 22, NO. 4, 243–252 https://doi.org/10.1080/19768354.2018.1497707 High-fat-diet impaired mitochondrial function of cumulus cells but improved the efficiency of parthenogenetic embryonic quality in mice a b a a a b b c Jingjing Li *, Shuang Wang *, Bo Wang , Hao Wei , Xin Liu , Jun Hao , Yanping Duan , Jinlian Hua , d,e b a Xiaomin Zheng , Xiuliang Feng and Xingrong Yan a b College of Life Sciences, Northwest University, Xi’an, People’s Republic of China; Department of Experimental Surgery of Xijing Hospital, Fourth Military Medical University, Xi’an, People’s Republic of China; Biotechnology, Northwest A&F University, Yangling, People’s Republic of China; Key Laboratory of Fertility Preservation and Maintenance, Ministry of Education, Key Laboratory of Reproduction and Genetics in Ningxia, Ningxia Medical University, Yinchuan, People’s Republic of China; Department of Histology and Embryology, Ningxia Medical University, Yinchuan, People’s Republic of China ABSTRACT ARTICLE HISTORY Received 22 January 2018 Global human health has been compromised by high-fat diets. This study aimed to investigate the Revised 16 April 2018 relationship between a high-fat diet and parthenogenetic embryo quality. Mice fed a high-fat or a Accepted 28 April 2018 normal diet was used as treated or control groups, respectively. Estradiol (E ), total cholesterol (TC) and total triglyceride (TG) were detected by Enzyme-Linked ImmunoSorbent Assay (ELISA). KEYWORDS Cumulus-oocyte complexes (COCs) were collected from the mice in the treated and control Embryo; high-fat diet; mouse; groups. The ultrastructure of COCs, the expression level of genes involved in mitochondrial and oocyte; parthenogenesis nuclear functions in cumulus cells and oocytes quality were evaluated with transmission electron microscopy, real-time quantitative polymerase chain reaction (RT-PCR) and artificial parthenogenesis, respectively. The results showed that the efficiency of parthenogenetic embryonic development in vitro was significantly higher in the treated group than in the control group (p < .05). The expression level of genes involved in mitochondrial function was lower in cumulus cells from the treated group than that from the control group (p < .05). The estradiol and cholesterol level in the serum and the expression level of P450 arom were higher in the treated group than the control group (p < .05). The reactive oxygen species (ROS) level was higher in culumus cells from the treated group than the control group, while the mitochondrial membrane potential was lower in cumulus cells from the treated group (p < .05). Accumulation of lipid droplets was only in cumulus but in oocyte, the results demonstrated that mitochondrial functions were impaired by a high-fat diet, but parthenogenetic embryonic development in vitro was improved, in controllable range of damage for the body. Introduction such as skeletal muscle, liver, and heart, due to increased Obesity is an increasing public health concern for humans, cellular uptake of exogenous fatty acids (Cuevas et al. as it can cause many diseases, such as diabetes, cardiovas- 2004). Increased levels of intracellular free fatty acids in cular disease and other metabolic diseases at rapid rates the absence of obesity could also lead to the formation (Kulie et al. 2011). Since it is directly related to the health of cytotoxins due to oxidative damage, especially for intra- of the next generation, women’s health is gradually becom- cellular organelles, such as mitochondria and the endoplas- ing more of a public focus compared with men’shealth. mic reticulum (ER) (Borengasser et al. 2011). One of these Therefore, obesity is an important cause of many diseases organelles, the mitochondria, is the intracellular energy- in women (Thangaratinam et al. 2012). More importantly, generating organelle that determines cell activity. There- obese women have high rates of infertility compared fore, mitochondria are important for the development of with their lean counterparts. However, obesity could be oocytes and embryos. Obesity can also lead to insulin caused by many factors, such as consumption of excess cal- resistance and inflammatory changes (Shoelson et al. ories and calorie-dense foods, sedentary behavior and 2007). Insulin resistance increases the level of glucose in intake of a high-fat diet (Rey-López et al. 2008). In the body, and moreover, lipogenesis could be enhanced obesity, lipids could assemble in non-adipose tissues, to protect against high intracellular glucose levels. CONTACT Xiuliang Feng xlfeng@fmmu.edu.cn Department of Experimental Surgery of Xijing Hospital Fourth Military Medical University, 710069 Xi’an, People’s Republic of China, Xingrong Yan xingrongyan2007@126.com College of Life Sciences, Northwest University, 710069 Xi’an, People’s Republic of China *These authors contributed equally to this work. © 2018 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 244 J. LI ET AL. Inflammatory changes could be triggered by obesity, as control group were fed the normal food with 4.5% fat, adipocyte can secrete pro-inflammatory cytokines, such 19% protein and 5% carbohydrate as a control. as tumor necrosis factor α (TNFα) and monocyte chemoat- tractant protein-1 (MCP-1), which are relevant to insulin Histochemical stains and ultra structural analysis resistance (Kim et al. 2012). Thus, obesity is a vicious of COCs cycle in animals and is difficult to control through a single method. COCs were collected from the oviducts of treated and Extensive investigations have focused on the effect control groups 16 h after super-ovulation. And then the of obesity on the reprogramming of embryos during ovaries and cornua uteri were harvested from mice pregnancy (Srinivasan et al. 2008). The status of after collection of COCs. Ovaries and cornua uteri were embryo development at the early stage, especially pre- fixed with 4% paraformaldehyde for 48 h, dehydrated implantation, is an index used to evaluate embryo with different concentrations of ethanol, and embedded developmental competence. Early embryonic develop- in paraffin. The paraffin-embedded tissues were cut into ment is supported and controlled by the oocyte, 5-µm slices with a Leica RM 2165. Subsequently, the sec- which is specifically a very large germ cell. An oocyte tions were deparaffinized, rehydrated and stained with maintains its normal activities with help from the hematoxylin–eosin (Lee et al. 1999). The procedure was cumulus cells surrounding it. Therefore, oocytes may performed by the improved method from the previous be directly affected by cumulus cells, as these cells are report. The COCs were fixed for 2 d in phosphate linked by gap junctions between them (Lisle et al. buffered solution (PBS) containing 2.5% glutaraldehyde, 2013). The nutrition and hormones of the oocyte are then fixed for 2 h in 1% osmium tetroxide in PBS (Palmer- supported by cumulus; for example, cumulus cells can ini et al. 2014). The specimens were dehydrated in an secrete E via aromatizing enzyme. Many attempts increasing series of ethanol, infiltrated with a propylene have been made to predict oocyte quality by identifying oxide, and embedded in Epon-Araldite (Epon-812) cumulus cell states (Wathlet et al. 2012). Previous (TAAB, UK). Ultrathin sections (70 nm) were cut with a reports showed that high insulin could promote diamond knife, stained with 3% uranyl acetate and glucose uptake in cumulus cells, rather than oocytes. 0.6% lead citrate, and examined with a transmission elec- Cumulus cells control the metabolism of glucose and tron microscope (Chung and Moon 2011). provide energy substrates and intermediates, such as pyruvate, to the oocyte (Purcell et al. 2012). Sufficient energy can maintain an oocyte and better support for Detection of e , cholesterol and triglyceride (TG) embryo development. Previous reports have used levels in serum adult animal models to investigate the relationship Detection of E , TC and TG was performed as previously between a high-fat diet and reproduction (Wu et al. described(Schliepetal. 2015). Blood was collected from 2010). In this study, 4-week-old mice were fed a high- the heart when COCs were recovered from the mice. The fat diet to determine whether these results are the serum was separated from the blood by centrifugation same as those in adult animal models. and was preserved at –20°C for further use. The level of E , TC and TG were determined using an ELISA Kit (Joyee Biotechnics, Shanghai, China), and the absorbance was Materials and methods detected with a microplate reader, according to the man- Animals ufacturer’sinstructions(infinite F50, Tecan, Switzerland). Female ICR mice (4 weeks old) were purchased after ablac- tation. The mice were divided into treated group and Artificial parthenogenetic activation and control group with 30 mice respectively. Mice were raised cultivation of oocytes under the following conditions: light/dark: 12 h/12 h. All handling procedures were carried out in accordance with Oocytes were artificially activated by culturing in Ca the guidelines of the Experimental Animal Holding Unit of -free Chatot & Ziomek & Bavister (CZB) medium with fourth Military Medical University (ethics approval number 10 mM SrCl and 5 µg/ml cytochalasin B for 6 h (Yan 2006731019). A high-fat diet was prepared as described in et al. 2013). The activated oocytes were cultured in pot- a previous report; briefly, the diet contained 22% fat, 19% assium simplex optimization medium (KSOM) over-laid protein, and 49.5% carbohydrate (Wu et al. 2010). Female with mineral oil in an incubator (37°C, 5% CO and satu- mice in a treated group were prepared for use after being rated humidity). The quality of parthenogenetic embryos fed a high-fat diet for 4 weeks, while the the mice in was assessed using morphological criteria at 3.5 d. ANIMAL CELLS AND SYSTEMS 245 Extraction of mRNA and quantitative polymerase Identification of reactive oxygen species (ROS) chain reaction (qPCR) and mitochondrial membrane potential in cumulus cells Extraction of total RNA from cumulus cells and qPCR were performed as described in a previous report (Jin et al. For ROS, COCs were collected from the oviduct, washed 2015). Briefly, primers were designed from the published in M2 medium for two times, cultured in 2,7-Dichlorodi– sequence in GenBank. RNA quality was determined hydrofluorescein diacetate (DCFH-DA) medium for using the β-actin gene, which was amplified with 30 min in an incubator (37°C, 5% CO and saturated specific primers (across introns). The primer sequences humidity), and washed in M2 medium for three times are shown in Table 1. RT-PCR was performed using a to eliminate DCFH-DA. COCs were observed using a con- Light Cycler (Roche Molecular Biochemicals, Mannheim, focal microscope and analyzed by IPP. For mitochondrial Germany) and a commercially available SYBR-Premix Ex membrane potential, COCs were treated with the follow- TaqTM II kit (Takara, Japan) according to the manufac- ing methods. COCs were evaluated with a mitochondrial turer’s instructions. After the addition of reagents (final membrane potential kit, which was used according to volume: 50 μL), 40 cycles of denaturation (94°C for 1 s), manufacturer’s instructions in their manual. Briefly, ′ ′ ′ ′ annealing (59°C for 10 s), and extension (72°C for 10 s) COCs were cultured in 5,5 ,6,6 -Tetrachloro-1,1 ,3,3 -tetra- were performed. After the completion of PCR amplifica- ethyl-imidacarbocyanine iodide (JC-1) work buffer for 20 tion, melt curve analysis was performed. The experiment min (37°C, 5% CO2 and saturated humidity) and washed was repeated for three times. in JC-1 wash buffer (without JC-1) for three times. COCs were observed under a confocal microscope, and the fluorescence was quantified by IPP software (Media Table 1. Oligonucleotide primer sets used for RT-PCR Cybernetics, Bethesda, MD, USA). Gene Primer Primer sequence Product ′ ′ bax Forward 5 -TACAGGGTTTCATCCAGG-3 167bp primer ′ ′ Reverse 5 -GTCAGCAATCATCCTCTG-3 Results primer ′ ′ bcl2 Forward 5 -GAGTTAGTTCGTCTGAGTAG-3 112bp Structure of the ovary and ultrastructure of primer ′ ′ Reverse 5 -ATAGGTCAAGAGGGAGTG-3 cumulus cells primer ′ ′ Sox2 Forward 5 -TACAGGGTTTCATCCAGG-3 167bp In the ovary, there were more follicles in the treated primer ′ ′ group than the control group, and more vasculature Reverse 5 -GTCAGCAATCATCCTCTG-3 primer was observed in the ovaries from the treated group ′ ′ P450arom Forward 5 ATC AAG CAG CAT TTG GAC CG 3 140bp (Figure 1(A,B)). To analyze the effects of a high-fat diet primer ′ ′ Reverse 5 ACA ATA GCA CTT TCG TCC AG 3 on the nucleus and cytoplasm of cumulus cells in primer COCs, the observation was noted: the nucleus was ′ ′ C-myc Forward 5 -ACTTCTCCACCGCCGATCAG-3 211bp located at the center of cells, and the nuclear mem- primer ′ ′ Reverse 5 -AGGCTGGTGCTGTCTTTGCG-3 brane was intact in both groups. Mitochondrial, the ER primer ′ ′ and ribosomes were distributed in the cytoplasm. All Tim23 Forward 5 CTGACT GGTATGAACCCCCT 3 121bp primer the mitochondria had clear cristae. In the treated ′ ′ Reverse 5 CTAGTTCAAATCTGCCTCGG 3 5 group, there were several large lipid droplets and primer ′ ′ Pnpt1 Forward 5 CCCACAAACTACCTTAGAAG 3 191bp more ribosomes in the cytoplasm of cumulus cells primer (Figure 1(C,D)). ′′ ′ Reverse 5 - GCTACAGAAGCACCATTAAC-3 primer ′ ′ Cyto C Forward 5 TTCAGAAGTGTGCCCAGTGC 3 147bp primer ′ ′ E , cholesterol and TG level in the serum and Reverse 5 TCCCCCCGTTACCTTTGTTC 3 primer expression of p450 arom in cumulus cells ′ ′ Cox II Forward 5 CCTCTCTACGCATTCTATAT 3 124bp primer High-fat diet could increase the level of TC and TG in ′ ′ Reverse 5 GAATCA AAG CATAGGTCT TC 3 primer obese mouse (Wang et al. 2017). In this study, the level ′ ′ β-actin Forward 5 -GCGGCATCCACGAAACTAC-3 120bp of TC in treated group was higher than that of the primer ′ ′ control group (163.8 ± 14.7 VS 88.5 ± 9.6; p <.01) (Figure Reverse 5 -TGATCTCCTTCTGCATCCTGTC-3 primer 2(A)), but level of TG had no significant difference ′ ′ GAPDH Forward 5 AGAAGGTGGTGAAGCAGGCA 3 111bp between the two group (85.0 ± 17.8 VS 98.2 ± 15.1; p primer ′ ′ Reverse 5 CGAAGGTGGAAGAGTGGGAG 3 >.05) (Figure 2(B)). E level in serum from the treated primer group was significantly higher than that in the control 246 J. LI ET AL. Figure 1. Structure of ovary and ultrastructure of cumulus in treated and control mice. HE staining showed that different stages of follicles were present in ovaries from treated (A) and control (B) mice. The ultrastructure of cumulus cells was observed by SEM (C and D); many diploids were assembled in cumulus cells from treated mice (D). F: follicle, G: granule, O: oocyte, V; vasculature, AF: atretic follicle, L: lipid droplet, N: nucleus, M: mitochondrion, ER: endoplasm reticulum. group (p <.05) (Figure 2(C)). Cholesterol is reverted to tes- Expression of mitochondrial and nuclear function- tosterone in follicular cells. E is mainly synthesized from related genes in cumulus cells testosterone by P450 arom in cumulus cells(Kato et al. The expression of mitochondrial function-related genes 2013). The expression level of p450 arom in cumulus as tim23(Translocase of inner mitochondrial membrane cells in the treated group was clearly higher than that in 23), tom40(translocase of the outer mitochondrial mem- the control group (p <.01) (Figure 2(D)). These results brane 40), pnpt1(polyribonucleotide nucleotidyltransfer- demonstrated that a high-fat diet could increase TC to ase 1), cox II (cytochrome c oxidase II), and cyto C elevate the level of E by the catalyst of P450 arom in (cytochrome C) (Figure 4(A–E)) was determined by cumulus cells. qPCR, which showed that the expression levels of tim23, tom40, pnpt1, and cyto C were significantly lower in the treated group than the control group (p < .05) Number of ovulated oocytes and parthenogenetic (Figure 4(A–C,E)). For the nuclear genes, the expression development levels of Sox2(SRY (sex determining region Y)-box 2), The oocytes and embryonics from both the control group c-myc (cancer-myelocytomatosis oncogene)and bcl2 and treated group were tested by the inverted microscrope (B cell leukemia/lymphoma 2) were significantly higher (Figure 3(A–H)). To determine the effects of a high-fat diet in the control group (p < .05) (Figure 4(F,G,H)). on ovulation and oocyte quality, we isolated oocytes from the treated and control groups for artificial parthenogenetic activation. The results showed that more oocytes were ovu- High-fat diet can decrease the mitochondrial lated from the treated group (33.6 ± 4.8) than the control membrane potential and increase the level of ROS group (26.1 ± 4.0) (p < .05) (Figure 3(I)). There was no signifi- cant difference in the cleavage rate of parthenogenetic The ratio of green and blue fluorescence was used to embryos (86.6 ± 4.3% VS 87.7 ± 3.9%, p > .05). However, evaluate the ROS level. The ROS level was higher in the rate of embryos developing from the 2-cell stage to the treated group compared with the control group blastocysts was greater in the treated group (73.3 ± 3.1%) (p < .05) (Figure 5 A1-G1). JC-1 was used to detect the than the control group (62.2 ± 3.9%) (p < .05) (Figure 3(G)). membrane potential of mitochondria. The ratio of red This suggested that the quality of oocytes could be and green fluorescence was used to evaluate the mito- improved in vitro by a high-fat diet. chondrial membrane potential. The mitochondrial ANIMAL CELLS AND SYSTEMS 247 Figure 2. TC, TG and E level in serum and p450 arom expression in cumulus. Level of TC(A), TG(B), E (C) levels in serum and the 2 2 expression of p450 arom(D) were detected in the treated group and control group (**: p < .01). The data shown represent three inde- pendent experiments (mean ± SD; *: p < .05). membrane potential in the treated group was signifi- influenced by a high-fat diet. Unexpectedly, the quality cantly lower than that in the control group (p < .01) and number of oocytes were improved in mice fed a (Figure 5(A2–I2)). high-fat diet for 4 weeks (Figure 3), in which the possible cause is different sensitivity of the mouse strain for high- fat diet; CBA mouse is possibly easier to be damaged by Discussion high-fat diet, such as many accumulation of lipids and Obesity is a worldwide epidemic that could compromise vacuoles in mitochondria (Wu et al. 2010). But in this human health. Obesity can impair the function of many study, accumulation of lipid only appeared in few human organs, such as the reproductive system (Kulie cumulus, with normal structure of mitochondria but an et al. 2011). With improvements in the living standard, increase of ribosome. It suggested that ICR mouse has humans are consuming more high-fat diets. A high-fat better ability to resist damage of high-fat diet, compared diet could cause obesity and other diseases (Zhou et al. with CBA mice. Therefore, oocyte quality was improved 2014). Obesity could impair the function of the reproduc- by utilization of energy from high-fat diet before appear- tive system, and oocytes derived from mice fed a high-fat ing as lipotoxicity. Oocyte quality is an important factor diet had dramatically increased lipid content; thus, the in many processes, such as fertilization in vitro and in quality of oocytes could be impaired (Wu et al. 2010, vivo, nuclear transfer and parthenogenesis. Our previous Luzzo et al. 2012). A high-fat diet also induced oocyte report showed that oocyte quality could be determined meiotic aneuploidy and fetal growth restriction/brain by artificial parthenogenetic activation, which is a simple defects (Luzzo et al. 2012). In our primary experiment, method for detecting oocyte quality (Xu et al. 2017). it was intriguing to see how oocyte quality was Many factors are related to oocyte quality. Among 248 J. LI ET AL. Figure 3. Number of ovulated oocyte and rate of embryo development in vitro. The oocytes from the control group and treated group were obtained by superovulated (A,E). The oocytes through parthenogenetic activation develop to pronuclear-stage (B,F), the pronuclear zygote (C,G) and the blastocyst (D,H) continuously. The number of ovulated oocytes was determined, for the treated and control groups (I). The percentage of embryos reaching the 2-cell and blastocyst stages, based on the number of oocytes (G). The data obtained from three independent experiments are shown (mean ± SD; *: p < .05). these factors, the size of an oocyte is critical for develop- directly communicate with oocytes through gap junc- mental competence. Follicles with different sizes are tion. Thus, cumulus cells play an important role in responsible for oocyte development, and cumulus cells oocyte developmental competence. Some studies have ANIMAL CELLS AND SYSTEMS 249 Figure 4. Expression of genes in cumulus. The expression of genes related to mitochondrial function (tim23 (A), tom40 (B), pnpt1 (C), Cox II (D), Cyto C (E), and Sox2 (F)) and nuclear function (C-myc (G), bcl2 (H), and pnpt1 (I)) in cumulus cells, from the treated and control groups. The data obtained from three independent real-time experiments are shown (mean ± SD; *: p < .05). predicted oocyte quality from the expression profile of for cell damaged by increasing E .E could protect 2 2 genes in cumulus cells, and some candidate genes oocyte and cumulus from clomiphene citrate-induced have been selected (Caixeta et al. 2009). Our previous follicular cell apoptosis in mouse (Chaube et al. 2005). report suggested that the expression level of Sox2 in It was reported that alcohol can also significantly cumulus cells was relevant to oocyte quality (Tavernier increase the level of free E (Schliep et al. 2015, Jerome et al. 2011). However, in this study, the expression of et al. 2016). E can protect mouse mammary tissue Sox2 did not differ between the groups. Testosterone is from oxidative damage by maintaining the structure synthesized from cholesterol in follicular membrane and function of proteins, lipids, and DNA (Yuan et al. cells and is converted to E in the cumulus cells by 2016). In this study, the number of oocytes ovulated P450 arom. E is responsible for secondary sexual charac- and oocyte quality were improved, which could be teristics and influences oocyte development (Newman related to high levels of E . Previous research has also et al. 2008). Expression of P450 arom could be promoted reported that a high-fat diet can induce cell apoptosis by cholesterol in the serum (Kato et al. 2013). In this (Moraes et al. 2009). Expression of Bcl2 blocked apoptosis study, TC level in serum increased one fold, compared in myelodysplastic progenitors expressed as a Bcl2 trans- with control group, which was probably due to promot- gene (Slape et al. 2012). In this study, a high-fat diet ing expression of P450 arom in cumulus. It was induced low levels of expression of Bcl2 in cumulus suggested that a high-fat diet could influence the level cells, which could lead to apoptosis in cumulus cells of E in the serum by increasing the expression of p450 (Barlow et al. 2010). arom and level of cholesterol. It is a protective measure 250 J. LI ET AL. Figure 5. Mitochondrial membrane potential and ROS levels of cumulus cells. The mitochondrial membrane potential and ROS levels of cumulus cells, in control group and treated group, were obtained by confocal microscopy with the same microscope settings. To determine ROS levels, DCF staining identified the mitochondria (A1,D1), and Hoechst 33342 was used to label the nucleus (B1,E1). The fluerescences was merged (C1,F1). The relative fluorescence values based on the control were calculated for the treated and control groups (G1). Identification of the mitochondrial membrane potential. Red and green fluorescence indicate JC-1 aggregates (A2,E2) and monomers (B2,F2), respectively. Blue fluorescence is Hoechst 33342 in the nucleus (C2,G2). The three kinds of fluerescence were merged into one image. (D2,H2) The relative fluorescence intensity ratio of blue/green fluorescence based on the control is shown for the treated and control groups (I2). The data derived from three independent experiments are shown (mean ± SD; *: p < .05; bar: 50 µm). Abnormal gene expression could affect mitochondrial the cytoplasm of cumulus cells, and there were vesicles function (Cogliati et al. 2013). In previous reports, in a few mitochondria, which was in agreement with pre- cumulus cells and oocytes accumulated many lipid dro- vious reports. Abnormal gene expression could be plets in a mouse obesity model, leading to impaired related to reduce mitochondrial membrane potential oocyte quality (Wu et al. 2010, Luzzo et al. 2012). In the and a higher level of ROS, which was supported by a pre- present study, many lipid droplets only accumulated in vious report (Wang et al. 2010). But the accumulation of ANIMAL CELLS AND SYSTEMS 251 Jin H, Huang Y, Jin G, Xue Y, Qin X, Yao X, Yue W. 2015. The lipid droplets did not appeared in ooplasm, which was vitamin D receptor localization and mRNA expression in suggested that a high-fat diet did not significantly ram testis and epididymis. Anim Reprod Sci. 153:29–38. impact oocyte. E was probably capable to resist the Kato N, Hayasaka T, Takeda J, Osakabe M, Kurachi H. 2013. damage derived from the high-fat diet. Therefore, a Ovarian tumors with functioning stroma: a clinicopathologic high-fat diet induced mitochondrial dysfunction, but study with special reference to serum estrogen level, stromal oocyte quality was improved. The define mechanisms morphology, and aromatase expression. Int J Gynecol Pathol. 32:556–561. need further investigated. Kim KA, Gu W, Lee IA, Joh EH, Kim DH. 2012. High Fat diet- induced Gut microbiota exacerbates inflammation and obesity in mice via the TLR4 signaling pathway. PLoS ONE. Acknowledgements 7:e47713. The authors acknowledge the facilities and the scientific and Kulie T, Slattengren A, Redmer J, Counts H, Eglash A, Schrager S. technical assistance of others. 2011. Obesity and women’s health: an evidence-based review. J Am Board Fam Med. 24:75–85. Lee C, Moon DY, Jee YJ, Choi BT. 1999. Histochemistry of muco- Disclosure Statement substances on the pedal sole of five abalone species. Korean J Biol Sci. 3:253–258. No potential conflict of interest was reported in this study. Lisle RS, Anthony K, Randall MA, Diaz FJ. 2013. Oocyte-cumulus cell interactions regulate free intracellular zinc in mouse oocytes. Reproduction. 145:381–390. Funding Luzzo KM, Wang Q, Purcell SH, Chi M, Jimenez PT, Grindler N, Schedl T, Moley KH, Clarke H. 2012. High fat diet induced The authors also acknowledge the support by the National developmental defects in the mouse: oocyte meiotic aneu- Natural Science Foundation of China [No. 30900155] and the ploidy and fetal growth retardation/brain defects. PLoS Natural Science Foundation of Shaanxi Province, China [No. One. 7:e49217. 2014JM3062]. Moraes JC, Coope A, Morari J, Cintra DE, Roman EA, Pauli JR, Romanatto T, et al. 2009. High-fat diet induces apoptosis of hypothalamic neurons. PLoS One. 4:e5045. References Newman DM, Jones PL, Ingram BA. 2008. Age-related changes in ovarian characteristics, plasma sex steroids and fertility Barlow JL, Drynan LF, Hewett DR, Holmes LR, Lorenzo-Abalde S, during pubertal development in captive female Murray cod Lane AL, Jolin HE, Pannell R, Middleton AJ, Wong See H, et al. maccullochella peelii peelii. Compar Biochem Physiol A Mol 2010. A p53-dependent mechanism underlies macrocytic Integr Physiol. 150:444. anemia in a mouse model of human 5q- syndrome. Nat Palmerini MG, Nottola SA, Leoni GG, Succu S, Borshi X, Med. 16:59–66. Berlinguer F, Naitana S, et al. 2014. In vitro maturation is Borengasser SJ, Lau F, Kang P, Blackburn ML, Ronis MJJ, Badger slowed in prepubertal lamb oocytes: ultrastructural evi- TM, Shankar K. 2011. Maternal obesity during gestation dences. Reprod Biol Endocrinol. 12:1–13. impairs fatty acid oxidation and mitochondrial SIRT3 Purcell SH, Chi MM, Lanzendorf S, Moley KH. 2012. Insulin- expression in Rat offspring at weaning. PLoS ONE. 6:e24068. stimulated glucose uptake occurs in specialized cells within Caixeta ES, Figueiredo PR, Machado GM, Franco MM, Buratini J, the cumulus oocyte complex. Endocrinology. 153:2444– Dode MAN. 2009. 180 expression of candidate genes for oocyte competence in bovine cumulus cells. Reprod Fert Rey-López JP, Vicente-Rodríguez G, Biosca M, Moreno LA. 2008. Dev. 21:189–189. Sedentary behaviour and obesity development in children Chaube SK, Prasad PV, Thakur SC, Shrivastav TG. 2005. Estradiol and adolescents. Metab Cardiovas Dis. 18:242–251. protects clomiphene citrate-induced apoptosis in ovarian Schliep KC, Zarek SM, Schisterman EF, Wactawski-Wende J, follicular cells and ovulated cumulus-oocyte complexes. Trevisan M, Sjaarda LA, Perkins NJ, Mumford SL, et al. 2015. Fert Ster. 84:1163–1172. Alcohol intake, reproductive hormones, and menstrual Chung KH, Moon MJ. 2011. Microstructure of the antennal cycle function: a prospective cohort study. Am J Clin Nutr. sensory organs in female millipede Oxidus gracilis 102:933–942. (Polydesmida: Paradoxomatidae). Animal Cell Syst. 15:53–61. Shoelson SE, Herrero L, Naaz A. 2007. Obesity, inflammation, Cogliati S, Frezza C, Soriano ME, Varanita T, Quintana-Cabrera R, and insulin resistance. Gastroenterology. 132:2169–2180. Corrado M, Costa V, Casarin A, Gomes LC, Perales-Clemente Slape CI, Saw J, Jowett JB, Aplan PD, Strasser A, Jane SM, Curtis E, et al. 2013. Mitochondrial cristae shape determines respir- DJ. 2012. Inhibition of apoptosis by BCL2 prevents leukemic atory chain supercomplexes assembly and respiratory transformation of a murine myelodysplastic syndrome. efficiency. Cell. 155:160–171. Blood. 120:2475–2483. Cuevas A, Miquel JF, Reyes MS, Zanlungo S, Nervi F. 2004. Diet Srinivasan M, Dodds C, Ghanim H, Gao T, Ross PJ, Browne RW, as a risk factor for cholesterol gallstone disease. J Am Coll Dandona P, Patel MS, et al. 2008. Maternal obesity and Nutr. 23:187–196. fetal programming: effects of a high-carbohydrate nutri- Jerome A, Srivastava SK, Sharma RK. 2016. Study on follicular tional modification in the immediate postnatal life of characteristics, hormonal and biochemical profile in norges- female rats. Am J Physiol Endocrinol Metab. 295:E895–E903. tomet + PMSG treated acyclic buffaloes. Iran J Vet Res. 17:247–252. 252 J. LI ET AL. Tavernier G, Wolfrum K, Adjaye J, Smedt SCD, Rejman J. development and pregnancy for ICSI patients. Hum 2011. Reprogramming of fibroblasts using mRNA encod- Reprod:1–27. ing four reprogramming factors. Human Gene Therapy. Wu LL, Dunning KR, Yang X, Russell DL, Lane M, Norman RJ, 22:A27–A27. Robker RL. 2010. High-fat diet causes lipotoxicity responses Thangaratinam S, Rogozińska E, Jolly K, Glinkowski S, Duda W, in cumulus-oocyte complexes and decreased fertilization Borowiack E, Roseboom T, et al. 2012. Interventions to rates. Endocrinology. 151:5438–5445. reduce or prevent obesity in pregnant women: a systematic Xu WL, Huo LH, Li JJ, Xu CL, Wang S, Yang YH, Liu C, et al. 2017. review. Health Technol Assess. 16:1–191. Effects of alcohol on mitochondrial functions of cumulus Wang Q, Frolova AI, Purcell S, Adastra K, Schoeller E, Chi MM, cells in mice. Cell Reprogram. 19(2):123. Schedl T, Moley KH, Dey SK. 2010. Mitochondrial dysfunction Yan XR, Yang YH, Zheng XM, et al. 2013. Expression of FGF4 and apoptosis in cumulus cells of type I diabetic mice. PLoS mRNA is mediated by mating behaviours in mice. Cell One. 5:e15901. Biochem Funct. 31:526–531. Wang CC, Yen JH, Cheng YC, Lin CY, Hsieh CT, Gau RJ, Chiou SJ, Yuan L, Dietrich AK, Ziegler YS, Nardulli AM. 2016.17β-Estradiol Chang HY. 2017. Polygala tenuifolia extract inhibits lipid alters oxidative damage and oxidative stress response accumulation in 3T3-L1 adipocytes and high-fat diet–induced protein expression in the mouse mammary gland. Mol Cell obese mouse model and affects hepatic transcriptome and Endocrinol. 426:11–21. gut microbiota profiles. Food Nutr Res. 61:1654–1661. Zhou XL, Xu JJ, Ni YH, Chen XC, Zhang HX, Zhang XM, Liu WJ, Wathlet S, Adriaenssens T, Segers I, Verheyen G, Velde HVD, et al. 2014. Impaired uterine artery flow associated with Coucke W, ElR R, et al. 2012. Cumulus cell gene expression the presence of ovarian endometrioma: preliminary results predicts better cleavage-stage embryo or blastocyst of a prospective study. J Ovarian Res. 7:1–12.
http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png
Animal Cells and Systems
Taylor & Francis
http://www.deepdyve.com/lp/taylor-francis/high-fat-diet-impaired-mitochondrial-function-of-cumulus-cells-but-gNO9Hxw98A
