Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Isolation and inheritance of microsatellite loci for the oily bittering (Acheilognathus koreensis): applications for analysis of genetic diversity of wild populations

Isolation and inheritance of microsatellite loci for the oily bittering (Acheilognathus... EVOLUTION & SYSTEMATIC BIOLOGY Animal Cells and Systems Vol. 16, No. 4, August 2012, 321328 Isolation and inheritance of microsatellite loci for the oily bittering (Acheilognathus koreensis): applications for analysis of genetic diversity of wild populations a a a b a a Woo-Jin Kim *, Hee Jeong Kong , Eun-Ha Shin , Chi Hong Kim , Hyung Soo Kim , Young-Ok Kim , a a a a Bo-Hye Nam , Bong-Seok Kim , Sang-Jun Lee and Hyung Taek Jung Biotechnology Research Division, National Fisheries Research and Development Institute, Busan 619-705, Republic of Korea; Central Regional Inland Fisheries Research, National Fisheries Research and Development Institute, Gapyeong, Gyeonggi-do 477-815, Republic of Korea (Received 26 July 2011; received in revised form 10 October 2011; accepted 26 November 2011) The oily bittering Acheilognathus koreensis is a freshwater species that is endemic to Korea and is experiencing severe declines in natural populations as a result of habitat fragmentation and water pollution. For the conservation and restoration of this species, it is necessary to assess its genetic diversity at the population level. We developed 13 polymorphic microsatellite loci that were used to analyze the genetic diversity of two populations collected from the Kum River and the Tamjin River in Korea. All loci exhibited Mendelian inheritance patterns when examined in controlled crosses. Both populations revealed high levels of variability, with the number of alleles ranging from 3 to 20 and observed and expected heterozygosities ranging from 0.500 to 0.969 and from 0.529 to 0.938, respectively. None of the loci showed significant deviation from HardyWeinberg equilibrium, and one pair of loci showed significant linkage disequilibrium after Bonferroni correction. Pairwise F and genetic ST distance estimation showed significant differences between two populations. These results suggest that the microsatellites developed herein can be used to study the genetic diversity, population structure and conservation measure of A. koreensis. Keywords: Acheilognathus koreensis; genetic diversity; microsatellite loci; oily bittering Introduction DNA (RAPD; Williams et al. 1990) have proven useful for assessing population characteristics. Nevertheless, The bitterings are of the subfamily Acheilognathinae, each of these marker systems has drawbacks. For which includes approximately 40 species and subspecies. example, RFLP analysis is arduous and requires large They are a small freshwater fish with a deep body and a amounts of high-quality DNA as well as labeled semi-inferior mouth. Bitterings are distributed in tem- probes, the AFLP technique is dependent on the perate regions of Europe and Asia, including Korea, dominant nature of the markers, and the RAPD Japan, Taiwan, and China (Banarescu 1990). The approach is relatively easy to handle without any Korean bitterings are classified into two genera and 14 sequence prerequisites but has poor consistency and species, including nine endemic species (Kim et al. low reproducibility. Microsatellite or simple sequence 2005). The oily bittering (Acheilognathus koreensis) repeat (SSR) markers have been used to overcome these used in the present study is a common freshwater fish limitations. Microsatellites are short, tandem-repeated endemic to Korea that inhabits the Kum, Seomjin, nucleotide motifs distributed throughout the genome. Nagdong, and Tamjin Rivers (Kim and Kim 1990; Kim Because they are highly polymorphic, easy to genotype, and Park 2002). Natural populations of this species have and co-dominantly inherited, they have been widely recently experienced severe declines as a result of habitat used in many marine species to evaluate population fragmentation and water pollution (Kim et al. 2011). genetic diversity (Kim et al. 2010), construct genetic Conservation projects are currently in progress to linkage maps (Kang et al. 2008), and perform pedigree promote increases in population size and distribution. analysis (McDonald et al. 2004). However, one of their However, knowledge of population genetic structure is limitations is the presence of null alleles. The misiden- fundamental for developing effective plans, and suitable tification of null alleles could lead to distortion in DNA markers are needed for evaluation of population segregation analysis, resulting in false estimates. genetic diversity. DNA markers such as restriction fragment length Thus, the Mendelian inheritance patterns for micro- polymorphisms (RFLPs; Ikeda and Taniguchi 2002), satellite loci should be determined in controlled amplified fragment length polymorphisms (AFLPs; parentoffspring lines prior to using them in popula- Vos et al. 1995) and random amplified polymorphic tion or parentage studies. The other limiting factor is *Corresponding author. Email: wjkim@nfrdi.go.kr ISSN 1976-8354 print/ISSN 2151-2485 online # 2012 Korean Society for Integrative Biology http://dx.doi.org/10.1080/19768354.2011.645554 http://www.tandfonline.com 322 W.-J. Kim et al. that these markers must be specifically developed for Nhe I and ligated into a Xba I-digested pUC18 vector, the species of interest, necessitating an initial cost followed by transformation into Escherichia coli DH5a associated with their identification, given the require- competent cells. Positive clones with repeats were ment for sequence information. However, once devel- identified by PCR with (GT) and M13 primers. A oped, these markers are easy to use, highly negative control with no template was included in each reproducible, and suitable for multiplexing. However, PCR. The PCR products were analyzed on 1.5% no microsatellite markers have been developed for A. agarose gels, and the clones producing two or more koreensis to date. Therefore, we developed a set of bands were considered to contain a microsatellite locus. polymorphic microsatellite markers and assessed their Plasmid DNA of positive clones was purified using an inheritance modes in the three A. koreensis families. We Acroprep 96-well filter plates (PALL). The plasmids also examined their genetic diversity in natural popula- were sequenced using the Big Dye Terminator reaction tions to assess their utility as genetic markers. kit on the ABI 3130xl automated sequencer (Applied Biosystems). Materials and methods Sample collection and DNA isolation Primer design A total of 58 individuals of oily bittering (A. koreensis) Primers were designed from the unique sequences were collected from the Kum River (N26) and flanking microsatellite motifs using the OLIGO 5.0 Tamjin River (N32), Korea. Genomic DNA was software (National Biosciences). PCR was performed extracted from the caudal fins using the TNES-urea using DNA samples originally used for microsatellite buffer method (Asahida et al. 1996). isolation to establish whether the desired size product was amplified. PCR reactions were performed in 15-mL reaction volumes containing 50 ng of genomic DNA, Production of A. koreensis families 1PCR buffer, 1.5 mM MgCl , 0.2 mM of each dNTP, 5 pmol of each primer, and 0.5 U of Taq DNA A. koreensis families were produced by single-pair polymerase. All amplifications were performed on a matings with A. koreensis adults caught from the PTC-220 thermal cycler (MJ Research). The amplifica- Deokcheon River in 2010 at the Biotechnology Re- tion was carried out under the following conditions: an search Division of the National Fisheries Research and initial denaturation at 958C for 15 min followed by 35 Development Institute (NFRDI), Korea. Three fe- cycles of denaturation at 958C for 30 s, annealing at males (F1F3) and three males (M1M3) were crossed temperatures ranging from 458Cto608C, and exten- in different combinations, and three families were sion at 728C for 30 s, and then a final extension at 728C successfully obtained (family A, M1xF1; family B, for 15 min. The PCR products (100 bp) were M2xF2; family C, M3xF3). A total of 30 juveniles analyzed on 1.5% agarose gels. Small-size PCR pro- were randomly sampled from each family when they ducts (B100 bp) were analyzed in the 3% metaphor were approximately 2 months old. The whole body of agarose gel (BioProduct). the juvenile was used to isolate genomic DNA. Isolation of microsatellites Genotyping A partial genomic library enriched for GT repeats was A total of 13 microsatellite loci were used to genotype constructed by slightly modifying the procedure de- the 58 A. koreensis individuals from two populations. scribed by Hamilton et al. (1999). Specifically, genomic For fluorescent detection of the PCR products, the DNA extracted from an adult A. koreensis was digested forward primer in each pair was end-labeled commer- with the enzymes Alu I and Rsa I (New England cially with the dyes 6FAM, NED, or HEX (Applied Biolabs), and DNA fragments ranging from 200 to Biosystems). PCR reactions performed in 10-mLvo- 800 bp were isolated and ligated to SNX/SNX rev lumes containing 10 ng of genomic DNA, 1 PCR linker sequences. Linker-ligated DNA was amplified buffer, 1.5 mM MgCl , 0.2 mM of each dNTP, 3 pmol using SNX as a polymerase chain reaction (PCR) of each primer, 0.5 Band Doctor, and 0.5 U of f-Taq primer, and PCR products were hybridized to biotiny- DNA polymerase (Solgent). A PCR cycle was used as lated (GT) probes attached to streptavidin-coated described above at the primer-specific annealing tem- magnetic beads (Promega). Following elution from the perature (Table 1). The lengths of the PCR products beads, the repeat-enriched DNA was made double were determined with an ABI 3130xl Genetic Analyzer stranded and amplified using SNX linker as a primer. (Applied Biosystems) using the GeneScan-400HD The amplified DNA was digested with the enzyme (ROX) size standard (Applied Biosystems) and Animal Cells and Systems 323 Table 1. Thirteen microsatellite loci from Acheilognathus koreensis and their amplification information. Locus Repeat motif Primer sequence (5?3?) T (8C) Length (bp) GenBank accession no. Ak64 (AC) F: 6FAM-GCCTGCTCTCGTGGTTACGC 60 89 JN315693 R: TGTCATGATGAACCACGATGCTC Ak110 (AC) F: HEX-AGATGTAAAAAGTGCCCATGTGTC 55 138 JN315694 R: AAGAAAAGAGGGTTGTGAGGTCA Ak154 (AC) F: NED-AGCACAAGAATTACACATCACCT 58 157 JN315695 R: CGTGACAAAACATGGAAACA Ak181 (TC) F: HEX-CTGACTCGATCAAGAGCATAAAT 55 154 JN315696 R: GAAGCACAAGGAACAATACTGAG Ak382 (TC) F: 6FAM-CAGCCATTGGAAGCGGTTAT 60 104 JN315697 R: AACGGATGTGTGGAGGTAGATTG Ak424 (TC) (AC) F: 6FAM-GAGTGATCGCAGCTAAATTAGAG 58 107 JN315698 6 15 R: ATCATAACCCTAATGCCATACAG Ak455 (GT) F: 6FAM-CACTGCTGAGTCTGAGCTTTTAT 58 108 JN315699 R: GGTTAAAGGTGTAATTACCAGCC Ak462 (GA) F: NED-TGCAAAGTCAGACAAGAGTTATC 58 171 JN315700 R: CTCTGACGTAGTGCTGCTG Ak468 (AC) F: NED-CAGCACAATGACAGTCTACCAAG 58 162 JN315701 R: ATCCCCAGGTGAGAGTCGT Ak474 (AC) F: 6FAM-CATGCATGTCCTCCTGTGTG 58 108 JN315702 R: TTACAAGCAACCAAACGAGAGAA Ak479 (AC) F: HEX-GAGGTCTGGGAATCATCAAAAC 58 125 JN315703 R: GTTGCTATGGATACCGTCTGTCT Ak625 (TC) (AC) F: HEX-GAGAAGCAGATGAGAATACACACT 60 126 JN315704 12 9 R: ACCAACATCACCCTAAAATACC Ak686 (AC) ... (AC) F: HEX-AGCGCATCGGAGAGGAGTGCTC 60 156 JN315705 6 9 R: TGCGGGGTCCTCTGAGATGTGTT ... , GCATACACACAAGCACGC; F, forward primer; R, reverse primer; T , optimal annealing temperature. analyzed using the software GeneScan 3.7 and Geno- families. To ascertain whether alleles are inherited in a typer 3.7 (Applied Biosystems). Mendelian fashion, observed genotypic ratios in off- spring to Mendelian expectations (1:1, 1:2:1, and 1:1:1:1) were analyzed using a x goodness-of-fit test. Data analysis The number of alleles, allelic frequencies, polymorph- Results ism information contents (PICs), and the observed and Development of A. koreensis microsatellite markers expected heterozygosities at each locus in each popula- tion were calculated using the CERVUS 3.0 program From approximately 1200 genomic library clones (Marshall et al. 1998). Deviations from HardyWein- examined, 800 clones with inserts were randomly berg equilibrium (HWE) for each population at each selected and screened for the repeat using PCR, which locus using a Markov-chain algorithm (Guo and yielding 576 (72%) true positive clones. These were Thompson 1992) and linkage disequilibrium of all sequenced, producing a total of 463 (58%) sequences pairs of loci were tested using the GENEPOP 3.4 containing SSRs, of which 276 (35%) were eliminated software (Raymond and Rousset 1995). We also because they possessed the no flanking sequences. estimated F values (Weir and Cockerham 1984), A total of 187 (23%) sequences containing microsatel- IS which can determine HWE departures within a popu- lites were finally obtained, and 136/187 (72.7%) of the lation. Genetic distances between populations were sequences contained AC/GT microsatellites, while 51/ estimated using the PHYLIP software package version 187 (27.3%) were found to contain TC/GA microsa- 3.68 (Felsenstein 1989) with (Ds) standard genetic tellites. Among the 187 microsatellites, 122 were perfect distance (Nei 1972). F was estimated using an (65.2%), 10 (5.4%) were imperfect, and 55 (29.2%) were ST ARLEQUIN software package version 1.1 (Schneider classified as compound. A total of 92 primer pairs from et al. 1997). The mode of inheritance and presence of the 187 sequences were designed to amplify micro- null alleles at 13 microsatellite loci was evaluated using satellite-containing regions of the genome; the other 95 DNA from parents and 30 offspring from each of three sequences were abandoned because they contained 324 W.-J. Kim et al. inserts that were too small or large (33/95) or contained (Ak181), with a mean value of 14.0 in the total repeat motifs that were too proximate to the cloning population. The number of alleles ranged from 3 to site (62/95). The numbers of repeats in these sequences 16, with a mean of 8.54 per locus in the Kum River ranged from 3 to 105 repeat units. Only 36 (39%) of the population and 4 to 20 with a mean of 9.23 in the 92 primer pairs tested successfully amplified the target Tamjin River population. The mean number of alleles region, and the remaining pairs either failed to amplify per locus was similar in the two populations, but there or produced nonspecific bands. Finally, we labeled 24 were marked differences for locus Ak154, which (26%) of the 36 primer pairs with fluorescence dyes exhibited 15 alleles from the Tamjin River and only because they exhibited polymorphisms in 10 different seven alleles from the Kum River. The mean number of A. koreensis individuals when PCR products were shared alleles between two populations was 3.77. An analyzed by agarose/metaphor-gel electrophoresis. average of 26.9% of the alleles detected was shared However, when PCR products were genotyped, 11/24 between the two populations. (46%) were not scorable due to excessive stutter, Measures of genetic variation for each population apparent amplification of multiple loci, and/or failure (PIC, and observed and expected heterozygosity) are to amplify DNA from a large number of individuals given in Table 3. In the Kum River, the obser- despite attempts at reoptimization. The repeat motif, ved heterozygosity ranged from 0.500 to 0.962 product size, and annealing temperatures at each of 13/ (mean0.766), and the expected heterozygosity ran- 24 (54%) microsatellite loci are presented in Table 1. ged from 0.529 to 0.938 (mean0.771). In the Tamjin Representative sequences for all 13 of the microsatellite River, the observed heterozygosity ranged from 0.563 regions were deposited into GenBank under the to 0.969 (mean0.738), and the expected heterozyg- accession numbers JN315693JN315705 (Table 1). osity ranged from 0.516 to 0.927 (mean0.749). Although it varied among loci, the mean observed heterozygosity was lower than the mean expected Inheritance of A. koreensis microsatellite loci heterozygosity for both populations. None of the loci The inheritance and segregation patterns for 13 micro- showed significant deviation from HWE (p0.01). satellite loci in the parents and offspring of three One pair of loci (Ak64 and Ak181) showed significant families are presented in Table 2. The various genotypic linkage disequilibrium after Bonferroni correction at combinations of mated males and females produced the total population level (pB0.004). The PIC of oily three different segregation ratios: 1:1, 1:2:1, and bittering from the Kum River (0.719) was higher than 1:1:1:1. Of the 39 genotypic ratios examined (13 that of oily bittering from the Tamjin River (0.707). All loci3 families), 38 genotypic frequencies (97%) were loci were tested for a inbreeding coefficient (F ), which IS in accordance with Mendelian expectations. For ex- was positive for three loci in two populations, indicat- ample, family C at the locus Ak64 produced the ing a deficit of heterozygotes, whereas for five loci, the expected segregation of 1:1:1:1 ratio given that the parameter was negative, indicating an excess of hetero- male and female parents were heterozygous for 83/89 zygous genotypes. A broad range in F index values IS and 89/107 genotypes, respectively (Table 2). The was found among the loci, ranging from 0.171 (Ak625 offspring exhibited four genotypes (83/89, 83/107, 89/ in the Tamjin River) to 0.237 (Ak468 in the Kum 89, and 89/107) that segregated according to expecta- River). The overall F value among all loci was higher IS tion (x 1.20, df3). Family C at the locus Ak424 than zero, indicating some level of heterozygote exhibited distorted segregation ratios (pB0.05) and deficiency. The Nei standard genetic distance based had an excess of heterozygotes (101/105). Additionally, on allele frequencies between two populations was 1.51. family A at locus Ak154 had both male and female The genetic differentiation (F ) between the two ST parents with a single homozygous genotype with populations was 0.195, which was statistically signifi- the same allele size (99). Thus, all offspring genotypes cant (pB0.01). were identical to both parents. Discussion Genetic diversity in A. koreensis populations Microsatellites have been widely used as genetic mar- Table 3 summarizes the genetic diversity of each kers in many marine organisms including flounder, population at each locus. The levels of genetic diversity oyster, and shrimp because of their high degree of varied depending on the locus. All loci were success- variability, which makes them powerful tools for fully amplified in two populations and found to be population genetic analyses (Carlsson et al. 2006; Liu polymorphic. A total of 182 alleles were detected at 13 et al. 2006; Kim et al. 2010). They have also been used loci analyzed in 58 individuals of oily bittering. The for freshwater fish such as Cambaroides similis (Ahn number of alleles per locus varied from 6 (Ak110) to 27 et al. 2011), Brycon opalinus (Barrosoa et al. 2005), and Animal Cells and Systems 325 Table 2. Inheritance of 13 microsatellite loci from three Acheilognathus koreensis families produced by controlled crosses. F1 offspring genotype F1 offspring genotype Parental Parental a b 2 2 Locus Family genotype N Observed number (expected number ) x Locus Family genotype N Observed number (expected number) x Ak64 A 89/91 30 89/89 89/91 0.53 Ak462 A 157/167 30 157/157 157/167 167/167 0.60 89/89 17(15) 13(15) 157/167 6(7.5) 15(15) 9(7.5) B 89/89 30 83/89 89/89 0.13 B 155/171 30 155/155 155/173 155/171 171/173 1.73 83/89 14(15) 16(15) 155/173 8(7.5) 5(7.5) 10(7.5) 7(7.5) C 83/89 30 83/89 83/107? 89/89 89/107 1.20 C 157/167 30 155/157 157/171 155/167 167/171 3.33 89/107 8(7.5) 9(7.5) 8(7.5) 5(7.5) 155/171 10(7.5) 5(7.5) 5(7.5) 10(7.5) Ak110 A 134/136 30 132/134 132/136 0.00 Ak468 A 153/163 30 153/153 153/163 163/163 1.20 132/132 15(15) 15(15) 153/163 5(7.5) 16(15) 9(7.5) B 132/136 30 132/132 132/136 136/136 0.40 B 153/163 30 147/153 147/163 0.53 132/136 6(7.5) 16(15) 8(7.5) 147/147 17(15) 13(15) C 134/136 30 132/134 134/136 132/136 136/136 2.27 C 153/159 30 153/153 153/163 153/159 159/163 0.67 132/136 6(7.5) 9(7.5) 10(7.5) 5(7.5) 153/163 6(7.5) 9(7.5) 7(7.5) 8(7.5) Ak154 A 99/99 30 99/99 - Ak474 A 99/101 30 99/105 99/115 101/105 101/115 2.80 99/99 30(30) 105/115 5(7.5) 11(7.5) 6(7.5) 8(7.5) B 109/119 30 101/109 109/109 101/119 109/119 3.33 B 101/113 30 101/105 101/115 105/113 113/115 2.53 101/109 7(7.5) 11(7.5) 4(7.5) 8(7.5) 105/115 7(7.5) 11(7.5) 5(7.5) 7(7.5) C 103/109 30 101/103 101/109 0.53 C 99/101 30 99/99 99/101 101/101 0.60 101/101 17(15) 13(15) 99/101 6(7.5) 15(15) 9(7.5) Ak181 A 122/160 30 122/148 122/158 148/160 158/160 1.47 Ak479 A 121/141 30 109/121 121/121 109/141 121/141 0.13 148/158 9(7.5) 7(7.5) 9(7.5) 5(7.5) 109/121 8(7.5) 7(7.5) 7(7.5) 8(7.5) B 100/100 30 100/122 100/160 0.13 B 121/141 30 109/121 113/121 109/141 113/141 2.27 122/160 16(15) 14(15) 109/113 11(7.5) 6(7.5) 6(7.5) 7(7.5) C 124/160 30 120/124 124/140 120/160 140/160 1.73 C 109/121 30 109/121 109/137 121/121 121/137 1.47 120/140 5(7.5) 7(7.5) 10(7.5) 8(7.5) 121/137 10(7.5) 6(7.5) 8(7.5) 6(7.5) Ak382 A 75/77 30 75/75 75/77 77/77 0.40 Ak625 A 115/125 30 115/123 115/127 123/125 125/127 5.47 75/77 9(7.5) 14(15) 7(7.5) 123/127 4(7.5) 5(7.5) 12(7.5) 9(7.5) B 85/101 30 75/85 77/85 75/101 77/101 0.13 B 125/127 30 115/125 125/125 115/127 125/127 2.27 75/77 8(7.5) 8(7.5) 7(7.5) 7(7.5) 115/125 6(7.5) 11(7.5) 6(7.5) 7(7.5) C 75/85 30 75/77 75/91 77/85 85/91 1.20 C 125/127 30 125/125 125/127 127/127 0.40 77/91 8(7.5) 5(7.5) 8(7.5) 9(7.5) 125/127 6(7.5) 16(7.5) 8(7.5) Ak424 A 95/105 30 95/95 95/105 105/105 1.13 Ak686 A 151/153 30 151/153 153/153 2.13 95/105 8(7.5) 17(15) 5(7.5) 153/153 19(15) 11(15) B 95/105 30 95/105 95/107 105/105 105/107 2.53 B 151/153 30 145/151 151/151 145/153 151/153 4.90 105/107 11(7.5) 7(7.5) 7(7.5) 5(7.5) 145/151 10(7.5) 11(7.5) 4(7.5) 5(7.5) C 101/105 30 97/101 101/105 97/105 105/105 10.3 C 145/151 30 145/145 145/153 145/151 151/153 1.20 97/105 4(7.5) 15(7.5) 6(7.5) 5(7.5) 145/153 8(7.5) 9(7.5) 8(7.5) 5(7.5) 326 W.-J. Kim et al. Chondrostoma lusitanicum (Sousa et al. 2008). However, until now, no information was available on the use of microsatellite markers for oily bittering (A. koreensis). Here, we isolated and characterized the first micro- satellite markers in this species and analyzed the population genetic diversity of two wild populations. The conventional protocols for isolating microsa- tellites are cost, time, and labor intensive, and the efficiency of microsatellite isolation is low, ranging from 0.045% to 12% (Zane et al. 2002). To overcome these challenges, several enrichment techniques have been developed, which are based on the principal of capturing microsatellites from genomic DNA by hy- bridization with synthetic oligonucleotides bound to Nylon membranes or magnetic particles (Zane et al. 2002). We constructed a microsatellite enrichment library for the oily bittering using (GT) biotin-labeled probes, and 80% (463/576) of the positive clones contained microsatellite repeats. This efficiency is lower than that in tilapia (96%; Carleton et al. 2002) but higher than that in cutlassfish (48%; An et al. 2010). A total of 72.7% of sequences contained AC/GT microsatellites in accordance with the GT probes, and 27.3% contained TC/GA microsatellites, which were randomly obtained without using any GA probes. This indicated that (AC) and (TC) repeats are widely n n distributed throughout the oily bittering genome. The close proximity of the repeat motifs to the cloning sites yielded possible primers for only 66.8% of the micro- satellites sequenced. This issue is common for both conventional and microsatellite-enriched genomic li- braries (Alghanim and Almirall 2003). It is common for microsatellite loci to exhibit null alleles (Banks et al. 1999; Jones et al. 1999), which were found in up to 25% of loci examined in humans (Callen et al. 1993). No obvious pattern has been observed for the occurrence of null alleles, so without data from controlled crosses, it is not possible to estimate null allele frequencies in a wild population. Thus, an inheritance study of microsatellite loci is a fundamental prerequisite for using molecular markers in genetic studies. Previous studies have emphasized the impor- tance of testing for the inheritance of potential genetic markers against known parentoffspring relationships (Jerry et al. 2004), and we found this process very valuable for detecting null alleles in oily bittering. With the exception of the Ak424 locus in family C, all 13 loci followed Mendelian inheritance patterns. It is reason- able to assume that this deviation in a single family at one locus may be caused by random variation. The incidence of segregation distortion (2.6%) that we observed was slightly lower than that reported in Japanese flounder (3.6%, Sekino and Hara 2001). Some authors have recommended that loci with null alleles should be excluded from parentage analyses Table 2 (Continued ) F1 offspring genotype F1 offspring genotype Parental Parental a b 2 2 Locus Family genotype N Observed number (expected number ) x Locus Family genotype N Observed number (expected number) x Ak455 A 108/122 30 108/122 122/122 1.20 122/122 12(15) 18(15) B 102/108 30 102/106 102/108 106/108 108/108 2.53 106/108 7(7.5) 5(7.5) 7(7.5) 11(7.5) C 102/106 30 102/106 102/108 106/106 106/108 1.20 106/108 8(7.5) 5(7.5) 9(7.5) 8(7.5) N is the number of offspring scored at each locus. Mendelian expectations in each genotypic class are shown in parentheses. c 2 Nominal significant deviation from Mendelian ratio (p B0.05). For p B0.05, critical x value is 7.82 for df (degree of freedom)  3, 5.99 for df  2, 3.84 for df  1. Chi-square analysis was not performed since both parents possessed homozygous genotypes. Animal Cells and Systems 327 Table 3. Genetic diversity parameters for the two A. koreensis populations. No. of alleles Kum River (N26) Tamjin River (N32) Total Shared N H H (P) PIC F N H H (P) PIC F A O E IS A O E IS Ak64 12 2 7 0.846 0.790(0.256) 0.748 0.072 7 0.844 0.793(0.668) 0.747 0.066 Ak110 6 1 3 0.500 0.529(0.844) 0.403 0.055 4 0.594 0.615(0.896) 0.534 0.034 Ak154 20 2 7 0.654 0.789(0.161) 0.740 0.174 15 0.719 0.820(0.096) 0.788 0.125 Ak181 27 7 14 0.885 0.882(0.154) 0.852 0.003 20 0.969 0.927(0.689) 0.906 0.046 Ak382 19 7 16 0.962 0.938(0.081) 0.914 0.025 10 0.813 0.855(0.471) 0.824 0.050 Ak424 10 3 7 0.769 0.728(0.020) 0.668 0.058 6 0.719 0.753(0.371) 0.698 0.047 Ak455 9 5 8 0.692 0.685(0.855) 0.638 0.011 6 0.750 0.743(0.616) 0.687 0.010 Ak462 19 5 12 0.885 0.851(0.453) 0.816 0.041 12 0.781 0.876(0.193) 0.848 0.110 Ak468 15 2 7 0.577 0.753(0.085) 0.698 0.237 10 0.594 0.611(0.630) 0.581 0.029 Ak474 13 6 11 0.769 0.867(0.037) 0.835 0.115 8 0.563 0.516(0.897) 0.489 0.092 Ak479 16 4 9 0.885 0.811(0.695) 0.774 0.092 11 0.750 0.845(0.685) 0.813 0.114 Ak625 9 3 7 0.885 0.811(0.667) 0.767 0.092 5 0.719 0.616(0.668) 0.554 0.171 Ak686 7 2 3 0.654 0.588(0.259) 0.497 0.114 6 0.781 0.763(0.270) 0.714 0.025 Mean 14 3.77 8.54 0.766 0.771(0.033) 0.719 0.006 9.23 0.738 0.749(0.813) 0.707 0.008 N, sample size; N , number of alleles; H , observed heterozygosity; H , expected heterozygosity; PIC, polymorphism information content; F , A O E IS population inbreeding coefficient. P is the value estimated by the Fisher’s exact test in the Markov-chain method. (Pemberton et al. 1995). The results obtained here was clear that 19.5% of total genetic variation corre- indicated that these loci could be useful for parentage sponded to differences at the population level, and the analysis, population genetic studies, and genetic map- remaining 80.5% was the result of differences among ping in A. koreensis. individuals. The population genetic distance calculated Gene heterozygosity, also referred to as gene by Nei’s standard method was 1.51, also indicating diversity, is a suitable parameter for investigating high differentiation between the two populations. genetic variation. For a marker to be useful for measuring genetic variation, it should have a hetero- zygosity of at least 0.3 (Takezaki and Nei 1996). The Conclusion range of expected heterozygosity of the markers in the In the present study, we developed the first set of two populations analyzed here was between 0.529 and microsatellite loci for A. koreensis. The microsatellite 0.938; thus, the markers were appropriate for measur- markers were polymorphic within populations and ing genetic variation. PIC value is related to the between populations. We provided a preliminary esti- availability and utilization efficiency of a marker; the mate of genetic diversity and population differentiation higher the PIC value of the marker is in a population, of the oily bittering. Moreover, these markers will be a the higher the heterozygote frequency is and the more useful for the study of population genetic structure and genetic information it provides (Arora et al. 2004). establishment of effective conservation strategies. We Genetic markers showing PIC values higher than 0.5 are currently performing analyses to determine the fine- are normally considered informative for population scale structuring of oily bittering populations in Korea. genetic analyses (Botstein et al. 1980). In this study, all of the 13 microsatellite loci were highly polymorphic. The mean PIC value across all loci exceeded 0.5, which Acknowledgements could provide sufficient information for the assessment This work was supported by a grant from the National of genetic diversity. Fisheries Research and Development Institute (RP-2011-BT- The F value is a useful measure for determining ST 050). genetic differentiation among populations, with differ- ent values indicating different degrees of variation. An F value within the range of 0.050.15 indicates References ST moderate differentiation, whereas 0.150.25 suggests Ahn DH, Park MH, Jung JH, Oh MJ, Kim S, Jung J, Min GS. 2011. Isolation and characterization of microsatellite substantial differentiation, and0.25 indicates very loci in the Korean crayfish, Cambaroides similis and high differentiation (Wright 1978). In this study, the application to natural population analysis. Anim Cells F value was 0.195 between the Kum River and ST Syst. 15:3743. Tamjin River populations, indicating that there was a Alghanim HJ, Almirall JR. 2003. Development of micro- substantial differentiation between two populations. It satellite markers in Cannabis sativa for DNA typing and 328 W.-J. Kim et al. genetic relatedness analyses. Anal Bioanal Chem Kim IS, Kim CH 1990. A new Acheilognathine fish, 376:12251233. Acheilognathus koreensis. (Pisces: Cyprinidae) from Kor- An HS, Lee JH, Noh JK, Kim HC, Park CJ, Min BH, ea. Korean J Ichthyol. 2:4752. Myeong JI. 2010. Ten new microsatellite markers in Kim IS, Park JY. 2002. Freshwater fishes of Korea. Seoul: cutlassfish Trichiurus lepturus derived from an enriched Kyo-Hak Publishing Co. Ltd. (in Korean). genomic library. Anim Cells Syst. 14:169174. Kim IS, Choi Y, Lee CL, Lee YJ, Kim BY, Kim JH. 2005. Arora R, Lakhchaura BD, Prasad RB, Tantia MS, Vijh RK. Illustrated book of Korean fishes. Seoul: Kyu-Hak 2004. Genetic diversity analysis of two buffalo popula- Publishing Co. Ltd. (in Korean). tions of northern India using microsatellite markers. J Kim WJ, Kim KK, Han HS, Nam BH, Kim YO, Kong HJ, Anim Breed Genet. 121:111118. Noh JK, Yoon M. 2010. Population structure of the olive Asahida T, Kobayashi T, Saitoh K, Nakayama I. 1996. Tissue flounder (Paralichthys olivaceus) in Korea inferred from preservation and total DNA extraction from fish stored microsatellite marker analysis. J Fish Biol. 76:19581971. at ambient temperature using buffers containing high Kim CH, Lee WO, Lee JH, Beak JM. 2011. Reproduction concentration of urea. Fisheries Sci. 62:727730. study of Korean endemic species Acheilognathus koreenis. Banarescu P. 1990. Zoogeography of fresh waters. General Korean J Ichthyol. 23:150157. distribution and dispersal of freshwater animals. Wiesba- Liu P, Meng XH, Kong J, He YY, Wang QY. 2006. den: AULA-Verlag GmbH. Polymorphic analysis of microsatellite DNA in wild Banks MA, Blouin MS, Baldwin BA, Rashbrook VK, populations of Chinese shrimp (Fenneropenaeus Fitzgerald HA, Blankenship SM, Hedgecock D. 1999. chinensis). Aquac Res. 37:556562. Isolation and inheritance of novel microsatellites in Marshall TC, Slate J, Kruuk LEB, Pemberton JM. 1998. Chinook salmon (Oncorhynchus tshawytscha). J Hered. Statistical confidence for likelihood-based paternity in- 90:281288. ference in natural populations. Mol Ecol. 7:639655. Barrosoa RM, Hilsdorf AWS, Moreira HLM, Cabellod PH, McDonald GJ, Danzmann RG, Ferguson MM. 2004. Relat- Traub-Csekod YM. 2005. Genetic diversity of wild and edness determination in the absence of pedigree informa- cultured populations of Brycon opalinus (Cuvier, 1819) tion in three cultured strains of rainbow trout (Characiforme, Characidae, Bryconiae) using microsatel- (Oncorhynchus mykiss). Aquaculture. 233:6578. lites. Aquaculture 247:5165. Nei M. 1972. Genetic distance between populations. Am Nat. Botstein D, White RL, Skolnick M, Davis RW. 1980. 106:283292. Construction of a genetic linkage map in man using Pemberton JM, Slate J, Bancroft DR, Barrett JR. 1995. restriction fragment length polymorphism. Am J Hum Nonamplifying alleles at microsatellite loci: a caution for Genet. 32:314331. parentage and population studies. Mol Ecol. 4:249252. Callen DF, Thimpson AD, Shen Y, Phillips HA, Richards RI, Raymond M, Rousset F. 1995. GENEPOP (Version 1.2): Mulley JC, Sutherland GR. 1993. Incidence and origin of population genetics software for exact tests and ecumeni- ‘‘null’’ alleles in the (AC)n microsatellite markers. Am J cism. J Hered. 86:248249. Hum Genet. 52:922927. Schneider S, Kueffer JM, Roessli D, Excoffier L. 1997. Carleton KL, Streelman JT, Lee BY, Garnhart N, Kidd M, ARLEQUIN version 1.1: a software for population Kocher TD. 2002. Rapid isolation of CA microsatellites genetic data analysis. Genetics and Biometry Laboratory, from the tilapia genome. Anim Genet. 33:140144. Switzerland: University of Geneva. Carlsson J, Morrison CL, Reece KS. 2006. Wild and Sekino M, Hara M. 2001. Inheritance characteristics of aquaculture populations of the eastern oyster compared microsatellite DNA loci in experimental families of using microsatellites. J Hered. 97:595598. Japanese flounder Paralichthys olivaceus. Mar Biotechnol. Felsenstein J. 1989. PHYLIP-phylogeny inference package 3:310315. (version 3.2). Cladistics. 5:164166. Sousa V, Penha F, Collares-Pereira MJ, Chikhi L, Coelho Guo SW, Thompson EA. 1992. Performing the exact test of MM. 2008. Genetic structure and signature of population HardyWeinberg proportions for multiple alleles. Bio- decrease in the critically endangered freshwater cyprinid metrics. 48:361372. Chondrostoma lusitanicum. Conserv Genet. 9:791805. Hamilton MB, Pincus EL, DiFiore A, Fleischer RC. 1999. Takezaki N, Nei M. 1996. Genetic distances and reconstruc- A universal linker and ligation procedures for construc- tion of phylogenetic trees from microsatellite DNA. tion of genomic DNA libraries enriched for microsatel- Genetics. 144:389399. lites. BioTechniques. 27:500507. Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Ikeda M, Taniguchi N. 2002. Genetic variation and diver- Hornes M, Frijters A, Pot J, Peleman J, Kuiper M, et al. gence in populations of ayu Plecoglossus altivelis, includ- 1995. AFLP: a new technique for DNA fingerprinting. ing endangered subspecies, inferred from PCR-RFLP Nucleic Acids Res. 23:44074414. analysis of the mitochondrial DNA D loop region. Weir BS, Cockerham CC. 1984. Estimating F-statistics for the Fisheries Sci. 68:1826. analysis of population structure. Evolution. 38:1358 Jerry DR, Preston NP, Crocos PJ, Keys S, Meadows JRS, Li Y. 2004. Parentage determination of Kuruma shrimp Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey Penaeus (Marsupenaeus) japonicus using microsatellite SV. 1990. DNA polymorphisms amplified by arbitrary markers (Bate). Aquaculture. 235:237247. primers are useful as genetic markers. Nucleic Acids Res. Jones AG, Stockwell CA, Walker A, Avise JC. 1999. The 18:65316535. molecular basis of a microsatellite null allele from the Wright S. 1978. Evolution and the genetics of populations. white sands pupfish. J Hered. 89:339342. Vol 4. Chicago: University of Chicago Press. Kang JH, Kim WJ, Lee WJ. 2008. Genetic linkage map of olive flounder, Paralichthys olivaceus. Int J Biol Sci. Zane L, Bargelloni L, Patarnello T. 2002. Strategies for 4:143149. microsatellite isolation: a review. Mol Ecol. 11:116. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Animal Cells and Systems Taylor & Francis

Isolation and inheritance of microsatellite loci for the oily bittering (Acheilognathus koreensis): applications for analysis of genetic diversity of wild populations

Download PDF
8 pages

Isolation and inheritance of microsatellite loci for the oily bittering (Acheilognathus koreensis): applications for analysis of genetic diversity of wild populations

Abstract

Abstract The oily bittering Acheilognathus koreensis is a freshwater species that is endemic to Korea and is experiencing severe declines in natural populations as a result of habitat fragmentation and water pollution. For the conservation and restoration of this species, it is necessary to assess its genetic diversity at the population level. We developed 13 polymorphic microsatellite loci that were used to analyze the genetic diversity of two populations collected from the Kum River and...
Loading next page...
 
/lp/taylor-francis/isolation-and-inheritance-of-microsatellite-loci-for-the-oily-dLQmoEOQzY
Publisher
Taylor & Francis
Copyright
Copyright Korean Society for Integrative Biology
ISSN
2151-2485
eISSN
1976-8354
DOI
10.1080/19768354.2011.645554
Publisher site
See Article on Publisher Site

Abstract

EVOLUTION & SYSTEMATIC BIOLOGY Animal Cells and Systems Vol. 16, No. 4, August 2012, 321328 Isolation and inheritance of microsatellite loci for the oily bittering (Acheilognathus koreensis): applications for analysis of genetic diversity of wild populations a a a b a a Woo-Jin Kim *, Hee Jeong Kong , Eun-Ha Shin , Chi Hong Kim , Hyung Soo Kim , Young-Ok Kim , a a a a Bo-Hye Nam , Bong-Seok Kim , Sang-Jun Lee and Hyung Taek Jung Biotechnology Research Division, National Fisheries Research and Development Institute, Busan 619-705, Republic of Korea; Central Regional Inland Fisheries Research, National Fisheries Research and Development Institute, Gapyeong, Gyeonggi-do 477-815, Republic of Korea (Received 26 July 2011; received in revised form 10 October 2011; accepted 26 November 2011) The oily bittering Acheilognathus koreensis is a freshwater species that is endemic to Korea and is experiencing severe declines in natural populations as a result of habitat fragmentation and water pollution. For the conservation and restoration of this species, it is necessary to assess its genetic diversity at the population level. We developed 13 polymorphic microsatellite loci that were used to analyze the genetic diversity of two populations collected from the Kum River and the Tamjin River in Korea. All loci exhibited Mendelian inheritance patterns when examined in controlled crosses. Both populations revealed high levels of variability, with the number of alleles ranging from 3 to 20 and observed and expected heterozygosities ranging from 0.500 to 0.969 and from 0.529 to 0.938, respectively. None of the loci showed significant deviation from HardyWeinberg equilibrium, and one pair of loci showed significant linkage disequilibrium after Bonferroni correction. Pairwise F and genetic ST distance estimation showed significant differences between two populations. These results suggest that the microsatellites developed herein can be used to study the genetic diversity, population structure and conservation measure of A. koreensis. Keywords: Acheilognathus koreensis; genetic diversity; microsatellite loci; oily bittering Introduction DNA (RAPD; Williams et al. 1990) have proven useful for assessing population characteristics. Nevertheless, The bitterings are of the subfamily Acheilognathinae, each of these marker systems has drawbacks. For which includes approximately 40 species and subspecies. example, RFLP analysis is arduous and requires large They are a small freshwater fish with a deep body and a amounts of high-quality DNA as well as labeled semi-inferior mouth. Bitterings are distributed in tem- probes, the AFLP technique is dependent on the perate regions of Europe and Asia, including Korea, dominant nature of the markers, and the RAPD Japan, Taiwan, and China (Banarescu 1990). The approach is relatively easy to handle without any Korean bitterings are classified into two genera and 14 sequence prerequisites but has poor consistency and species, including nine endemic species (Kim et al. low reproducibility. Microsatellite or simple sequence 2005). The oily bittering (Acheilognathus koreensis) repeat (SSR) markers have been used to overcome these used in the present study is a common freshwater fish limitations. Microsatellites are short, tandem-repeated endemic to Korea that inhabits the Kum, Seomjin, nucleotide motifs distributed throughout the genome. Nagdong, and Tamjin Rivers (Kim and Kim 1990; Kim Because they are highly polymorphic, easy to genotype, and Park 2002). Natural populations of this species have and co-dominantly inherited, they have been widely recently experienced severe declines as a result of habitat used in many marine species to evaluate population fragmentation and water pollution (Kim et al. 2011). genetic diversity (Kim et al. 2010), construct genetic Conservation projects are currently in progress to linkage maps (Kang et al. 2008), and perform pedigree promote increases in population size and distribution. analysis (McDonald et al. 2004). However, one of their However, knowledge of population genetic structure is limitations is the presence of null alleles. The misiden- fundamental for developing effective plans, and suitable tification of null alleles could lead to distortion in DNA markers are needed for evaluation of population segregation analysis, resulting in false estimates. genetic diversity. DNA markers such as restriction fragment length Thus, the Mendelian inheritance patterns for micro- polymorphisms (RFLPs; Ikeda and Taniguchi 2002), satellite loci should be determined in controlled amplified fragment length polymorphisms (AFLPs; parentoffspring lines prior to using them in popula- Vos et al. 1995) and random amplified polymorphic tion or parentage studies. The other limiting factor is *Corresponding author. Email: wjkim@nfrdi.go.kr ISSN 1976-8354 print/ISSN 2151-2485 online # 2012 Korean Society for Integrative Biology http://dx.doi.org/10.1080/19768354.2011.645554 http://www.tandfonline.com 322 W.-J. Kim et al. that these markers must be specifically developed for Nhe I and ligated into a Xba I-digested pUC18 vector, the species of interest, necessitating an initial cost followed by transformation into Escherichia coli DH5a associated with their identification, given the require- competent cells. Positive clones with repeats were ment for sequence information. However, once devel- identified by PCR with (GT) and M13 primers. A oped, these markers are easy to use, highly negative control with no template was included in each reproducible, and suitable for multiplexing. However, PCR. The PCR products were analyzed on 1.5% no microsatellite markers have been developed for A. agarose gels, and the clones producing two or more koreensis to date. Therefore, we developed a set of bands were considered to contain a microsatellite locus. polymorphic microsatellite markers and assessed their Plasmid DNA of positive clones was purified using an inheritance modes in the three A. koreensis families. We Acroprep 96-well filter plates (PALL). The plasmids also examined their genetic diversity in natural popula- were sequenced using the Big Dye Terminator reaction tions to assess their utility as genetic markers. kit on the ABI 3130xl automated sequencer (Applied Biosystems). Materials and methods Sample collection and DNA isolation Primer design A total of 58 individuals of oily bittering (A. koreensis) Primers were designed from the unique sequences were collected from the Kum River (N26) and flanking microsatellite motifs using the OLIGO 5.0 Tamjin River (N32), Korea. Genomic DNA was software (National Biosciences). PCR was performed extracted from the caudal fins using the TNES-urea using DNA samples originally used for microsatellite buffer method (Asahida et al. 1996). isolation to establish whether the desired size product was amplified. PCR reactions were performed in 15-mL reaction volumes containing 50 ng of genomic DNA, Production of A. koreensis families 1PCR buffer, 1.5 mM MgCl , 0.2 mM of each dNTP, 5 pmol of each primer, and 0.5 U of Taq DNA A. koreensis families were produced by single-pair polymerase. All amplifications were performed on a matings with A. koreensis adults caught from the PTC-220 thermal cycler (MJ Research). The amplifica- Deokcheon River in 2010 at the Biotechnology Re- tion was carried out under the following conditions: an search Division of the National Fisheries Research and initial denaturation at 958C for 15 min followed by 35 Development Institute (NFRDI), Korea. Three fe- cycles of denaturation at 958C for 30 s, annealing at males (F1F3) and three males (M1M3) were crossed temperatures ranging from 458Cto608C, and exten- in different combinations, and three families were sion at 728C for 30 s, and then a final extension at 728C successfully obtained (family A, M1xF1; family B, for 15 min. The PCR products (100 bp) were M2xF2; family C, M3xF3). A total of 30 juveniles analyzed on 1.5% agarose gels. Small-size PCR pro- were randomly sampled from each family when they ducts (B100 bp) were analyzed in the 3% metaphor were approximately 2 months old. The whole body of agarose gel (BioProduct). the juvenile was used to isolate genomic DNA. Isolation of microsatellites Genotyping A partial genomic library enriched for GT repeats was A total of 13 microsatellite loci were used to genotype constructed by slightly modifying the procedure de- the 58 A. koreensis individuals from two populations. scribed by Hamilton et al. (1999). Specifically, genomic For fluorescent detection of the PCR products, the DNA extracted from an adult A. koreensis was digested forward primer in each pair was end-labeled commer- with the enzymes Alu I and Rsa I (New England cially with the dyes 6FAM, NED, or HEX (Applied Biolabs), and DNA fragments ranging from 200 to Biosystems). PCR reactions performed in 10-mLvo- 800 bp were isolated and ligated to SNX/SNX rev lumes containing 10 ng of genomic DNA, 1 PCR linker sequences. Linker-ligated DNA was amplified buffer, 1.5 mM MgCl , 0.2 mM of each dNTP, 3 pmol using SNX as a polymerase chain reaction (PCR) of each primer, 0.5 Band Doctor, and 0.5 U of f-Taq primer, and PCR products were hybridized to biotiny- DNA polymerase (Solgent). A PCR cycle was used as lated (GT) probes attached to streptavidin-coated described above at the primer-specific annealing tem- magnetic beads (Promega). Following elution from the perature (Table 1). The lengths of the PCR products beads, the repeat-enriched DNA was made double were determined with an ABI 3130xl Genetic Analyzer stranded and amplified using SNX linker as a primer. (Applied Biosystems) using the GeneScan-400HD The amplified DNA was digested with the enzyme (ROX) size standard (Applied Biosystems) and Animal Cells and Systems 323 Table 1. Thirteen microsatellite loci from Acheilognathus koreensis and their amplification information. Locus Repeat motif Primer sequence (5?3?) T (8C) Length (bp) GenBank accession no. Ak64 (AC) F: 6FAM-GCCTGCTCTCGTGGTTACGC 60 89 JN315693 R: TGTCATGATGAACCACGATGCTC Ak110 (AC) F: HEX-AGATGTAAAAAGTGCCCATGTGTC 55 138 JN315694 R: AAGAAAAGAGGGTTGTGAGGTCA Ak154 (AC) F: NED-AGCACAAGAATTACACATCACCT 58 157 JN315695 R: CGTGACAAAACATGGAAACA Ak181 (TC) F: HEX-CTGACTCGATCAAGAGCATAAAT 55 154 JN315696 R: GAAGCACAAGGAACAATACTGAG Ak382 (TC) F: 6FAM-CAGCCATTGGAAGCGGTTAT 60 104 JN315697 R: AACGGATGTGTGGAGGTAGATTG Ak424 (TC) (AC) F: 6FAM-GAGTGATCGCAGCTAAATTAGAG 58 107 JN315698 6 15 R: ATCATAACCCTAATGCCATACAG Ak455 (GT) F: 6FAM-CACTGCTGAGTCTGAGCTTTTAT 58 108 JN315699 R: GGTTAAAGGTGTAATTACCAGCC Ak462 (GA) F: NED-TGCAAAGTCAGACAAGAGTTATC 58 171 JN315700 R: CTCTGACGTAGTGCTGCTG Ak468 (AC) F: NED-CAGCACAATGACAGTCTACCAAG 58 162 JN315701 R: ATCCCCAGGTGAGAGTCGT Ak474 (AC) F: 6FAM-CATGCATGTCCTCCTGTGTG 58 108 JN315702 R: TTACAAGCAACCAAACGAGAGAA Ak479 (AC) F: HEX-GAGGTCTGGGAATCATCAAAAC 58 125 JN315703 R: GTTGCTATGGATACCGTCTGTCT Ak625 (TC) (AC) F: HEX-GAGAAGCAGATGAGAATACACACT 60 126 JN315704 12 9 R: ACCAACATCACCCTAAAATACC Ak686 (AC) ... (AC) F: HEX-AGCGCATCGGAGAGGAGTGCTC 60 156 JN315705 6 9 R: TGCGGGGTCCTCTGAGATGTGTT ... , GCATACACACAAGCACGC; F, forward primer; R, reverse primer; T , optimal annealing temperature. analyzed using the software GeneScan 3.7 and Geno- families. To ascertain whether alleles are inherited in a typer 3.7 (Applied Biosystems). Mendelian fashion, observed genotypic ratios in off- spring to Mendelian expectations (1:1, 1:2:1, and 1:1:1:1) were analyzed using a x goodness-of-fit test. Data analysis The number of alleles, allelic frequencies, polymorph- Results ism information contents (PICs), and the observed and Development of A. koreensis microsatellite markers expected heterozygosities at each locus in each popula- tion were calculated using the CERVUS 3.0 program From approximately 1200 genomic library clones (Marshall et al. 1998). Deviations from HardyWein- examined, 800 clones with inserts were randomly berg equilibrium (HWE) for each population at each selected and screened for the repeat using PCR, which locus using a Markov-chain algorithm (Guo and yielding 576 (72%) true positive clones. These were Thompson 1992) and linkage disequilibrium of all sequenced, producing a total of 463 (58%) sequences pairs of loci were tested using the GENEPOP 3.4 containing SSRs, of which 276 (35%) were eliminated software (Raymond and Rousset 1995). We also because they possessed the no flanking sequences. estimated F values (Weir and Cockerham 1984), A total of 187 (23%) sequences containing microsatel- IS which can determine HWE departures within a popu- lites were finally obtained, and 136/187 (72.7%) of the lation. Genetic distances between populations were sequences contained AC/GT microsatellites, while 51/ estimated using the PHYLIP software package version 187 (27.3%) were found to contain TC/GA microsa- 3.68 (Felsenstein 1989) with (Ds) standard genetic tellites. Among the 187 microsatellites, 122 were perfect distance (Nei 1972). F was estimated using an (65.2%), 10 (5.4%) were imperfect, and 55 (29.2%) were ST ARLEQUIN software package version 1.1 (Schneider classified as compound. A total of 92 primer pairs from et al. 1997). The mode of inheritance and presence of the 187 sequences were designed to amplify micro- null alleles at 13 microsatellite loci was evaluated using satellite-containing regions of the genome; the other 95 DNA from parents and 30 offspring from each of three sequences were abandoned because they contained 324 W.-J. Kim et al. inserts that were too small or large (33/95) or contained (Ak181), with a mean value of 14.0 in the total repeat motifs that were too proximate to the cloning population. The number of alleles ranged from 3 to site (62/95). The numbers of repeats in these sequences 16, with a mean of 8.54 per locus in the Kum River ranged from 3 to 105 repeat units. Only 36 (39%) of the population and 4 to 20 with a mean of 9.23 in the 92 primer pairs tested successfully amplified the target Tamjin River population. The mean number of alleles region, and the remaining pairs either failed to amplify per locus was similar in the two populations, but there or produced nonspecific bands. Finally, we labeled 24 were marked differences for locus Ak154, which (26%) of the 36 primer pairs with fluorescence dyes exhibited 15 alleles from the Tamjin River and only because they exhibited polymorphisms in 10 different seven alleles from the Kum River. The mean number of A. koreensis individuals when PCR products were shared alleles between two populations was 3.77. An analyzed by agarose/metaphor-gel electrophoresis. average of 26.9% of the alleles detected was shared However, when PCR products were genotyped, 11/24 between the two populations. (46%) were not scorable due to excessive stutter, Measures of genetic variation for each population apparent amplification of multiple loci, and/or failure (PIC, and observed and expected heterozygosity) are to amplify DNA from a large number of individuals given in Table 3. In the Kum River, the obser- despite attempts at reoptimization. The repeat motif, ved heterozygosity ranged from 0.500 to 0.962 product size, and annealing temperatures at each of 13/ (mean0.766), and the expected heterozygosity ran- 24 (54%) microsatellite loci are presented in Table 1. ged from 0.529 to 0.938 (mean0.771). In the Tamjin Representative sequences for all 13 of the microsatellite River, the observed heterozygosity ranged from 0.563 regions were deposited into GenBank under the to 0.969 (mean0.738), and the expected heterozyg- accession numbers JN315693JN315705 (Table 1). osity ranged from 0.516 to 0.927 (mean0.749). Although it varied among loci, the mean observed heterozygosity was lower than the mean expected Inheritance of A. koreensis microsatellite loci heterozygosity for both populations. None of the loci The inheritance and segregation patterns for 13 micro- showed significant deviation from HWE (p0.01). satellite loci in the parents and offspring of three One pair of loci (Ak64 and Ak181) showed significant families are presented in Table 2. The various genotypic linkage disequilibrium after Bonferroni correction at combinations of mated males and females produced the total population level (pB0.004). The PIC of oily three different segregation ratios: 1:1, 1:2:1, and bittering from the Kum River (0.719) was higher than 1:1:1:1. Of the 39 genotypic ratios examined (13 that of oily bittering from the Tamjin River (0.707). All loci3 families), 38 genotypic frequencies (97%) were loci were tested for a inbreeding coefficient (F ), which IS in accordance with Mendelian expectations. For ex- was positive for three loci in two populations, indicat- ample, family C at the locus Ak64 produced the ing a deficit of heterozygotes, whereas for five loci, the expected segregation of 1:1:1:1 ratio given that the parameter was negative, indicating an excess of hetero- male and female parents were heterozygous for 83/89 zygous genotypes. A broad range in F index values IS and 89/107 genotypes, respectively (Table 2). The was found among the loci, ranging from 0.171 (Ak625 offspring exhibited four genotypes (83/89, 83/107, 89/ in the Tamjin River) to 0.237 (Ak468 in the Kum 89, and 89/107) that segregated according to expecta- River). The overall F value among all loci was higher IS tion (x 1.20, df3). Family C at the locus Ak424 than zero, indicating some level of heterozygote exhibited distorted segregation ratios (pB0.05) and deficiency. The Nei standard genetic distance based had an excess of heterozygotes (101/105). Additionally, on allele frequencies between two populations was 1.51. family A at locus Ak154 had both male and female The genetic differentiation (F ) between the two ST parents with a single homozygous genotype with populations was 0.195, which was statistically signifi- the same allele size (99). Thus, all offspring genotypes cant (pB0.01). were identical to both parents. Discussion Genetic diversity in A. koreensis populations Microsatellites have been widely used as genetic mar- Table 3 summarizes the genetic diversity of each kers in many marine organisms including flounder, population at each locus. The levels of genetic diversity oyster, and shrimp because of their high degree of varied depending on the locus. All loci were success- variability, which makes them powerful tools for fully amplified in two populations and found to be population genetic analyses (Carlsson et al. 2006; Liu polymorphic. A total of 182 alleles were detected at 13 et al. 2006; Kim et al. 2010). They have also been used loci analyzed in 58 individuals of oily bittering. The for freshwater fish such as Cambaroides similis (Ahn number of alleles per locus varied from 6 (Ak110) to 27 et al. 2011), Brycon opalinus (Barrosoa et al. 2005), and Animal Cells and Systems 325 Table 2. Inheritance of 13 microsatellite loci from three Acheilognathus koreensis families produced by controlled crosses. F1 offspring genotype F1 offspring genotype Parental Parental a b 2 2 Locus Family genotype N Observed number (expected number ) x Locus Family genotype N Observed number (expected number) x Ak64 A 89/91 30 89/89 89/91 0.53 Ak462 A 157/167 30 157/157 157/167 167/167 0.60 89/89 17(15) 13(15) 157/167 6(7.5) 15(15) 9(7.5) B 89/89 30 83/89 89/89 0.13 B 155/171 30 155/155 155/173 155/171 171/173 1.73 83/89 14(15) 16(15) 155/173 8(7.5) 5(7.5) 10(7.5) 7(7.5) C 83/89 30 83/89 83/107? 89/89 89/107 1.20 C 157/167 30 155/157 157/171 155/167 167/171 3.33 89/107 8(7.5) 9(7.5) 8(7.5) 5(7.5) 155/171 10(7.5) 5(7.5) 5(7.5) 10(7.5) Ak110 A 134/136 30 132/134 132/136 0.00 Ak468 A 153/163 30 153/153 153/163 163/163 1.20 132/132 15(15) 15(15) 153/163 5(7.5) 16(15) 9(7.5) B 132/136 30 132/132 132/136 136/136 0.40 B 153/163 30 147/153 147/163 0.53 132/136 6(7.5) 16(15) 8(7.5) 147/147 17(15) 13(15) C 134/136 30 132/134 134/136 132/136 136/136 2.27 C 153/159 30 153/153 153/163 153/159 159/163 0.67 132/136 6(7.5) 9(7.5) 10(7.5) 5(7.5) 153/163 6(7.5) 9(7.5) 7(7.5) 8(7.5) Ak154 A 99/99 30 99/99 - Ak474 A 99/101 30 99/105 99/115 101/105 101/115 2.80 99/99 30(30) 105/115 5(7.5) 11(7.5) 6(7.5) 8(7.5) B 109/119 30 101/109 109/109 101/119 109/119 3.33 B 101/113 30 101/105 101/115 105/113 113/115 2.53 101/109 7(7.5) 11(7.5) 4(7.5) 8(7.5) 105/115 7(7.5) 11(7.5) 5(7.5) 7(7.5) C 103/109 30 101/103 101/109 0.53 C 99/101 30 99/99 99/101 101/101 0.60 101/101 17(15) 13(15) 99/101 6(7.5) 15(15) 9(7.5) Ak181 A 122/160 30 122/148 122/158 148/160 158/160 1.47 Ak479 A 121/141 30 109/121 121/121 109/141 121/141 0.13 148/158 9(7.5) 7(7.5) 9(7.5) 5(7.5) 109/121 8(7.5) 7(7.5) 7(7.5) 8(7.5) B 100/100 30 100/122 100/160 0.13 B 121/141 30 109/121 113/121 109/141 113/141 2.27 122/160 16(15) 14(15) 109/113 11(7.5) 6(7.5) 6(7.5) 7(7.5) C 124/160 30 120/124 124/140 120/160 140/160 1.73 C 109/121 30 109/121 109/137 121/121 121/137 1.47 120/140 5(7.5) 7(7.5) 10(7.5) 8(7.5) 121/137 10(7.5) 6(7.5) 8(7.5) 6(7.5) Ak382 A 75/77 30 75/75 75/77 77/77 0.40 Ak625 A 115/125 30 115/123 115/127 123/125 125/127 5.47 75/77 9(7.5) 14(15) 7(7.5) 123/127 4(7.5) 5(7.5) 12(7.5) 9(7.5) B 85/101 30 75/85 77/85 75/101 77/101 0.13 B 125/127 30 115/125 125/125 115/127 125/127 2.27 75/77 8(7.5) 8(7.5) 7(7.5) 7(7.5) 115/125 6(7.5) 11(7.5) 6(7.5) 7(7.5) C 75/85 30 75/77 75/91 77/85 85/91 1.20 C 125/127 30 125/125 125/127 127/127 0.40 77/91 8(7.5) 5(7.5) 8(7.5) 9(7.5) 125/127 6(7.5) 16(7.5) 8(7.5) Ak424 A 95/105 30 95/95 95/105 105/105 1.13 Ak686 A 151/153 30 151/153 153/153 2.13 95/105 8(7.5) 17(15) 5(7.5) 153/153 19(15) 11(15) B 95/105 30 95/105 95/107 105/105 105/107 2.53 B 151/153 30 145/151 151/151 145/153 151/153 4.90 105/107 11(7.5) 7(7.5) 7(7.5) 5(7.5) 145/151 10(7.5) 11(7.5) 4(7.5) 5(7.5) C 101/105 30 97/101 101/105 97/105 105/105 10.3 C 145/151 30 145/145 145/153 145/151 151/153 1.20 97/105 4(7.5) 15(7.5) 6(7.5) 5(7.5) 145/153 8(7.5) 9(7.5) 8(7.5) 5(7.5) 326 W.-J. Kim et al. Chondrostoma lusitanicum (Sousa et al. 2008). However, until now, no information was available on the use of microsatellite markers for oily bittering (A. koreensis). Here, we isolated and characterized the first micro- satellite markers in this species and analyzed the population genetic diversity of two wild populations. The conventional protocols for isolating microsa- tellites are cost, time, and labor intensive, and the efficiency of microsatellite isolation is low, ranging from 0.045% to 12% (Zane et al. 2002). To overcome these challenges, several enrichment techniques have been developed, which are based on the principal of capturing microsatellites from genomic DNA by hy- bridization with synthetic oligonucleotides bound to Nylon membranes or magnetic particles (Zane et al. 2002). We constructed a microsatellite enrichment library for the oily bittering using (GT) biotin-labeled probes, and 80% (463/576) of the positive clones contained microsatellite repeats. This efficiency is lower than that in tilapia (96%; Carleton et al. 2002) but higher than that in cutlassfish (48%; An et al. 2010). A total of 72.7% of sequences contained AC/GT microsatellites in accordance with the GT probes, and 27.3% contained TC/GA microsatellites, which were randomly obtained without using any GA probes. This indicated that (AC) and (TC) repeats are widely n n distributed throughout the oily bittering genome. The close proximity of the repeat motifs to the cloning sites yielded possible primers for only 66.8% of the micro- satellites sequenced. This issue is common for both conventional and microsatellite-enriched genomic li- braries (Alghanim and Almirall 2003). It is common for microsatellite loci to exhibit null alleles (Banks et al. 1999; Jones et al. 1999), which were found in up to 25% of loci examined in humans (Callen et al. 1993). No obvious pattern has been observed for the occurrence of null alleles, so without data from controlled crosses, it is not possible to estimate null allele frequencies in a wild population. Thus, an inheritance study of microsatellite loci is a fundamental prerequisite for using molecular markers in genetic studies. Previous studies have emphasized the impor- tance of testing for the inheritance of potential genetic markers against known parentoffspring relationships (Jerry et al. 2004), and we found this process very valuable for detecting null alleles in oily bittering. With the exception of the Ak424 locus in family C, all 13 loci followed Mendelian inheritance patterns. It is reason- able to assume that this deviation in a single family at one locus may be caused by random variation. The incidence of segregation distortion (2.6%) that we observed was slightly lower than that reported in Japanese flounder (3.6%, Sekino and Hara 2001). Some authors have recommended that loci with null alleles should be excluded from parentage analyses Table 2 (Continued ) F1 offspring genotype F1 offspring genotype Parental Parental a b 2 2 Locus Family genotype N Observed number (expected number ) x Locus Family genotype N Observed number (expected number) x Ak455 A 108/122 30 108/122 122/122 1.20 122/122 12(15) 18(15) B 102/108 30 102/106 102/108 106/108 108/108 2.53 106/108 7(7.5) 5(7.5) 7(7.5) 11(7.5) C 102/106 30 102/106 102/108 106/106 106/108 1.20 106/108 8(7.5) 5(7.5) 9(7.5) 8(7.5) N is the number of offspring scored at each locus. Mendelian expectations in each genotypic class are shown in parentheses. c 2 Nominal significant deviation from Mendelian ratio (p B0.05). For p B0.05, critical x value is 7.82 for df (degree of freedom)  3, 5.99 for df  2, 3.84 for df  1. Chi-square analysis was not performed since both parents possessed homozygous genotypes. Animal Cells and Systems 327 Table 3. Genetic diversity parameters for the two A. koreensis populations. No. of alleles Kum River (N26) Tamjin River (N32) Total Shared N H H (P) PIC F N H H (P) PIC F A O E IS A O E IS Ak64 12 2 7 0.846 0.790(0.256) 0.748 0.072 7 0.844 0.793(0.668) 0.747 0.066 Ak110 6 1 3 0.500 0.529(0.844) 0.403 0.055 4 0.594 0.615(0.896) 0.534 0.034 Ak154 20 2 7 0.654 0.789(0.161) 0.740 0.174 15 0.719 0.820(0.096) 0.788 0.125 Ak181 27 7 14 0.885 0.882(0.154) 0.852 0.003 20 0.969 0.927(0.689) 0.906 0.046 Ak382 19 7 16 0.962 0.938(0.081) 0.914 0.025 10 0.813 0.855(0.471) 0.824 0.050 Ak424 10 3 7 0.769 0.728(0.020) 0.668 0.058 6 0.719 0.753(0.371) 0.698 0.047 Ak455 9 5 8 0.692 0.685(0.855) 0.638 0.011 6 0.750 0.743(0.616) 0.687 0.010 Ak462 19 5 12 0.885 0.851(0.453) 0.816 0.041 12 0.781 0.876(0.193) 0.848 0.110 Ak468 15 2 7 0.577 0.753(0.085) 0.698 0.237 10 0.594 0.611(0.630) 0.581 0.029 Ak474 13 6 11 0.769 0.867(0.037) 0.835 0.115 8 0.563 0.516(0.897) 0.489 0.092 Ak479 16 4 9 0.885 0.811(0.695) 0.774 0.092 11 0.750 0.845(0.685) 0.813 0.114 Ak625 9 3 7 0.885 0.811(0.667) 0.767 0.092 5 0.719 0.616(0.668) 0.554 0.171 Ak686 7 2 3 0.654 0.588(0.259) 0.497 0.114 6 0.781 0.763(0.270) 0.714 0.025 Mean 14 3.77 8.54 0.766 0.771(0.033) 0.719 0.006 9.23 0.738 0.749(0.813) 0.707 0.008 N, sample size; N , number of alleles; H , observed heterozygosity; H , expected heterozygosity; PIC, polymorphism information content; F , A O E IS population inbreeding coefficient. P is the value estimated by the Fisher’s exact test in the Markov-chain method. (Pemberton et al. 1995). The results obtained here was clear that 19.5% of total genetic variation corre- indicated that these loci could be useful for parentage sponded to differences at the population level, and the analysis, population genetic studies, and genetic map- remaining 80.5% was the result of differences among ping in A. koreensis. individuals. The population genetic distance calculated Gene heterozygosity, also referred to as gene by Nei’s standard method was 1.51, also indicating diversity, is a suitable parameter for investigating high differentiation between the two populations. genetic variation. For a marker to be useful for measuring genetic variation, it should have a hetero- zygosity of at least 0.3 (Takezaki and Nei 1996). The Conclusion range of expected heterozygosity of the markers in the In the present study, we developed the first set of two populations analyzed here was between 0.529 and microsatellite loci for A. koreensis. The microsatellite 0.938; thus, the markers were appropriate for measur- markers were polymorphic within populations and ing genetic variation. PIC value is related to the between populations. We provided a preliminary esti- availability and utilization efficiency of a marker; the mate of genetic diversity and population differentiation higher the PIC value of the marker is in a population, of the oily bittering. Moreover, these markers will be a the higher the heterozygote frequency is and the more useful for the study of population genetic structure and genetic information it provides (Arora et al. 2004). establishment of effective conservation strategies. We Genetic markers showing PIC values higher than 0.5 are currently performing analyses to determine the fine- are normally considered informative for population scale structuring of oily bittering populations in Korea. genetic analyses (Botstein et al. 1980). In this study, all of the 13 microsatellite loci were highly polymorphic. The mean PIC value across all loci exceeded 0.5, which Acknowledgements could provide sufficient information for the assessment This work was supported by a grant from the National of genetic diversity. Fisheries Research and Development Institute (RP-2011-BT- The F value is a useful measure for determining ST 050). genetic differentiation among populations, with differ- ent values indicating different degrees of variation. An F value within the range of 0.050.15 indicates References ST moderate differentiation, whereas 0.150.25 suggests Ahn DH, Park MH, Jung JH, Oh MJ, Kim S, Jung J, Min GS. 2011. Isolation and characterization of microsatellite substantial differentiation, and0.25 indicates very loci in the Korean crayfish, Cambaroides similis and high differentiation (Wright 1978). In this study, the application to natural population analysis. Anim Cells F value was 0.195 between the Kum River and ST Syst. 15:3743. Tamjin River populations, indicating that there was a Alghanim HJ, Almirall JR. 2003. Development of micro- substantial differentiation between two populations. It satellite markers in Cannabis sativa for DNA typing and 328 W.-J. Kim et al. genetic relatedness analyses. Anal Bioanal Chem Kim IS, Kim CH 1990. A new Acheilognathine fish, 376:12251233. Acheilognathus koreensis. (Pisces: Cyprinidae) from Kor- An HS, Lee JH, Noh JK, Kim HC, Park CJ, Min BH, ea. Korean J Ichthyol. 2:4752. Myeong JI. 2010. Ten new microsatellite markers in Kim IS, Park JY. 2002. Freshwater fishes of Korea. Seoul: cutlassfish Trichiurus lepturus derived from an enriched Kyo-Hak Publishing Co. Ltd. (in Korean). genomic library. Anim Cells Syst. 14:169174. Kim IS, Choi Y, Lee CL, Lee YJ, Kim BY, Kim JH. 2005. Arora R, Lakhchaura BD, Prasad RB, Tantia MS, Vijh RK. Illustrated book of Korean fishes. Seoul: Kyu-Hak 2004. Genetic diversity analysis of two buffalo popula- Publishing Co. Ltd. (in Korean). tions of northern India using microsatellite markers. J Kim WJ, Kim KK, Han HS, Nam BH, Kim YO, Kong HJ, Anim Breed Genet. 121:111118. Noh JK, Yoon M. 2010. Population structure of the olive Asahida T, Kobayashi T, Saitoh K, Nakayama I. 1996. Tissue flounder (Paralichthys olivaceus) in Korea inferred from preservation and total DNA extraction from fish stored microsatellite marker analysis. J Fish Biol. 76:19581971. at ambient temperature using buffers containing high Kim CH, Lee WO, Lee JH, Beak JM. 2011. Reproduction concentration of urea. Fisheries Sci. 62:727730. study of Korean endemic species Acheilognathus koreenis. Banarescu P. 1990. Zoogeography of fresh waters. General Korean J Ichthyol. 23:150157. distribution and dispersal of freshwater animals. Wiesba- Liu P, Meng XH, Kong J, He YY, Wang QY. 2006. den: AULA-Verlag GmbH. Polymorphic analysis of microsatellite DNA in wild Banks MA, Blouin MS, Baldwin BA, Rashbrook VK, populations of Chinese shrimp (Fenneropenaeus Fitzgerald HA, Blankenship SM, Hedgecock D. 1999. chinensis). Aquac Res. 37:556562. Isolation and inheritance of novel microsatellites in Marshall TC, Slate J, Kruuk LEB, Pemberton JM. 1998. Chinook salmon (Oncorhynchus tshawytscha). J Hered. Statistical confidence for likelihood-based paternity in- 90:281288. ference in natural populations. Mol Ecol. 7:639655. Barrosoa RM, Hilsdorf AWS, Moreira HLM, Cabellod PH, McDonald GJ, Danzmann RG, Ferguson MM. 2004. Relat- Traub-Csekod YM. 2005. Genetic diversity of wild and edness determination in the absence of pedigree informa- cultured populations of Brycon opalinus (Cuvier, 1819) tion in three cultured strains of rainbow trout (Characiforme, Characidae, Bryconiae) using microsatel- (Oncorhynchus mykiss). Aquaculture. 233:6578. lites. Aquaculture 247:5165. Nei M. 1972. Genetic distance between populations. Am Nat. Botstein D, White RL, Skolnick M, Davis RW. 1980. 106:283292. Construction of a genetic linkage map in man using Pemberton JM, Slate J, Bancroft DR, Barrett JR. 1995. restriction fragment length polymorphism. Am J Hum Nonamplifying alleles at microsatellite loci: a caution for Genet. 32:314331. parentage and population studies. Mol Ecol. 4:249252. Callen DF, Thimpson AD, Shen Y, Phillips HA, Richards RI, Raymond M, Rousset F. 1995. GENEPOP (Version 1.2): Mulley JC, Sutherland GR. 1993. Incidence and origin of population genetics software for exact tests and ecumeni- ‘‘null’’ alleles in the (AC)n microsatellite markers. Am J cism. J Hered. 86:248249. Hum Genet. 52:922927. Schneider S, Kueffer JM, Roessli D, Excoffier L. 1997. Carleton KL, Streelman JT, Lee BY, Garnhart N, Kidd M, ARLEQUIN version 1.1: a software for population Kocher TD. 2002. Rapid isolation of CA microsatellites genetic data analysis. Genetics and Biometry Laboratory, from the tilapia genome. Anim Genet. 33:140144. Switzerland: University of Geneva. Carlsson J, Morrison CL, Reece KS. 2006. Wild and Sekino M, Hara M. 2001. Inheritance characteristics of aquaculture populations of the eastern oyster compared microsatellite DNA loci in experimental families of using microsatellites. J Hered. 97:595598. Japanese flounder Paralichthys olivaceus. Mar Biotechnol. Felsenstein J. 1989. PHYLIP-phylogeny inference package 3:310315. (version 3.2). Cladistics. 5:164166. Sousa V, Penha F, Collares-Pereira MJ, Chikhi L, Coelho Guo SW, Thompson EA. 1992. Performing the exact test of MM. 2008. Genetic structure and signature of population HardyWeinberg proportions for multiple alleles. Bio- decrease in the critically endangered freshwater cyprinid metrics. 48:361372. Chondrostoma lusitanicum. Conserv Genet. 9:791805. Hamilton MB, Pincus EL, DiFiore A, Fleischer RC. 1999. Takezaki N, Nei M. 1996. Genetic distances and reconstruc- A universal linker and ligation procedures for construc- tion of phylogenetic trees from microsatellite DNA. tion of genomic DNA libraries enriched for microsatel- Genetics. 144:389399. lites. BioTechniques. 27:500507. Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Ikeda M, Taniguchi N. 2002. Genetic variation and diver- Hornes M, Frijters A, Pot J, Peleman J, Kuiper M, et al. gence in populations of ayu Plecoglossus altivelis, includ- 1995. AFLP: a new technique for DNA fingerprinting. ing endangered subspecies, inferred from PCR-RFLP Nucleic Acids Res. 23:44074414. analysis of the mitochondrial DNA D loop region. Weir BS, Cockerham CC. 1984. Estimating F-statistics for the Fisheries Sci. 68:1826. analysis of population structure. Evolution. 38:1358 Jerry DR, Preston NP, Crocos PJ, Keys S, Meadows JRS, Li Y. 2004. Parentage determination of Kuruma shrimp Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey Penaeus (Marsupenaeus) japonicus using microsatellite SV. 1990. DNA polymorphisms amplified by arbitrary markers (Bate). Aquaculture. 235:237247. primers are useful as genetic markers. Nucleic Acids Res. Jones AG, Stockwell CA, Walker A, Avise JC. 1999. The 18:65316535. molecular basis of a microsatellite null allele from the Wright S. 1978. Evolution and the genetics of populations. white sands pupfish. J Hered. 89:339342. Vol 4. Chicago: University of Chicago Press. Kang JH, Kim WJ, Lee WJ. 2008. Genetic linkage map of olive flounder, Paralichthys olivaceus. Int J Biol Sci. Zane L, Bargelloni L, Patarnello T. 2002. Strategies for 4:143149. microsatellite isolation: a review. Mol Ecol. 11:116.

Journal

Animal Cells and Systems – Taylor & Francis

Published: Aug 1, 2012

Keywords: Acheilognathus koreensis; genetic diversity; microsatellite loci; oily bittering

References

  • Illustrated book of Korean fishes
  • ARLEQUIN version 1.1: a software for population genetic data analysis