DeepDyve requires Javascript to function. Please enable Javascript on your browser to continue.
Measurement of altered APP isoform expression in adipose tissue of diet-induced obese mice by absolute quantitative real-time PCR Measurement of altered APP isoform expression in adipose tissue of diet-induced obese mice by...
Min, Hansol; Kim, Jinil; Kim, Young-Jin; Yoon, Mi-Sook; Pratley, Richard E.; Lee, Yong-Ho
2017-03-04 00:00:00
ANIMAL CELLS AND SYSTEMS, 2017 VOL. 21, NO. 2, 100–107 http://dx.doi.org/10.1080/19768354.2017.1290679 Measurement of altered APP isoform expression in adipose tissue of diet-induced obese mice by absolute quantitative real-time PCR a a b c d a Hansol Min *, Jinil Kim *, Young-Jin Kim , Mi-Sook Yoon , Richard E. Pratley and Yong-Ho Lee a b Department of Biomedical Science, Catholic University of Daegu, Gyeongsan, Korea; Department of Biomedical Engineering, Catholic c d University of Daegu, Gyeongsan, Korea; Division of Beauty Coordination, Keimyung College University, Daegu, Korea; Florida Hospital Sanford/ Burnham Translational Research Institute for Metabolism and Diabetes, Orlando, FL, USA ABSTRACT ARTICLE HISTORY Received 2 November 2016 Obesity is associated with increased risk of Alzheimer’s disease. Previous studies have demonstrated Revised 12 January 2017 that amyloid-beta precursor protein (APP) is expressed in subcutaneous adipose tissue (SAT), Accepted 18 January 2017 upregulated with obesity, and correlates with insulin resistance and adipose tissue inflammation. APP is alternatively spliced into several isoforms, which may be indicative of the pathogenesis of KEYWORDS APP-related diseases, but the accurate quantification has been difficult to standardize and Alternative splicing; amyloid- reproduce. In light of this, we developed isoform-specific absolute cDNA standards for absolute beta precursor protein (APP); quantitative real-time PCR (AQ-PCR), and measured transcript copy numbers for three major APP absolute quantitative real- isoforms (APP770, APP751, and APP695), in SAT from C57BL/6 mice fed either a normal or high- time PCR; obesity; adipose tissue fat diet. Expression of all three major APP isoforms was increased in diet-induced obese mice. Transcript copy numbers of APP770 and APP695 correlated with plasma insulin and CCL2 gene expression. The ratios of APP770 and APP751 to APP695 gradually decreased with aging, and correlated with plasma glucose levels. In addition, APP770 was significantly decreased in thiazolidinedione-treated mice. We describe quantification of APP isoform transcripts by AQ-PCR, which allows for direct comparison of gene copy number across isoforms, between experiments, and across studies conducted by independent research groups, which relative quantitative PCR does not allow. Our results suggest a possible role of differential expression of APP isoforms in the development of obesity-related insulin resistance and adipose tissue inflammation. In addition, it is important to determine if altered ratios of APP isoforms in SAT contribute to higher circulating Aβ peptides and increased risk of abnormalities in obesity. Introduction and Aβ plasma levels (Lee et al. 2008; Lee et al. 2009). We A hallmark pathological finding in Alzheimer’s disease recently demonstrated that similar cellular mechanisms (AD) was the presence of plaques in the central for production and effects of Aβ may exist between neur- nervous system that contained insoluble amyloid-β onal dysfunction in AD and adipose dysfunction in type 2 peptide (Aβ), resulting from proteolytic processing of diabetes (Tharp et al. 2016). In addition to these human amyloid-beta precursor protein (APP) (Hardy & Selkoe studies, we have demonstrated that SAT APP mRNA 2002). Although a great deal is known about the regu- expression levels were increased in diet-induced obese lation of APP expression in the central nervous system, mice and correlated with indices of glucose metabolism less is known about the regulation of APP expression, and insulin resistance (Jeong et al. 2014). processing, and function in peripheral tissues. In previous APP is alternatively spliced into several mRNA iso- gene expression studies with GeneChip microarrays, we forms in a tissue-specific manner. Each isoform can have demonstrated that APP mRNA expression was undergo processing to produce several peptide pro- higher in subcutaneous adipose tissue (SAT)/adipocytes ducts in addition to Aβ, each with multiple possible and preadipocytes from obese subjects (Lee et al. 2005; functions (Ling et al. 2003). The three major isoforms Nair et al. 2005; Lee et al. 2008). APP expression in adipo- of APP (APP770, APP751, and APP695) are derived cytes and SAT correlated with in vivo indices of insulin from alternative splicing that removes exon(s) 7 and/ resistance, the expression of proinflammatory genes, or 8; APP770 contains both, APP751 does not contain CONTACT Yong-Ho Lee ylee325@cu.ac.kr These authors contributed equally to this study. Supplemental data for this article can be accessed here: http://dx.doi.org/10.1080/19768354.2017.1290679 © 2017 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License (http://creativecommons.org/licenses/by-nc-nd/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited, and is not altered, transformed, or built upon in any way. MOLECULAR & CELLULAR BIOLOGY ANIMAL CELLS AND SYSTEMS 101 exon 8, and APP695 lacks exons 7 and 8. The APP751 Materials and methods and APP770 isoforms contain a 56-amino-acid Kunitz- Preparation of mouse APP isoform-specific type protease inhibitor (KPI) domain, whereas APP695 standards for AQ-PCR lacks this region (Zhao et al. 2015). APP695 has been described as the neuronally-predominant isoform. To create mouse APP isoform-specific standard curves, APP770 is widely expressed in peripheral tissues, but each isoform-specific DNA fragment was amplified and minimally in CNS tissue. isolated from the corresponding cDNA. PCR primer Several groups have documented variation in APP pairs were designed to amplify isoform-specific tran- isoform expression in multiple regions of the brain scripts for APP770, APP751, or APP695, and GAPDH affected by AD. Although APP695 is the abundant from cDNA libraries. Primers for each standard were isoform in the human brain, KPI-containing APP (APP- prepared to produce cDNAs with sequences encom- KPI) mRNA levels correlated with Aβ levels and the passing the target amplicon as measured by real- ratio of APP-KPI protein levels to total APP protein time PCR. Testing of empiric combinations yielded increased in AD (Matsui et al. 2007). Other data have pairs of specific primers (Table 1)which produced stan- also shown that the amount of APP-KPI increases in the dards of known size that could be resolved by agarose brain of patients with AD and is related to amyloid gel electrophoresis. A standard sample of each isoform fibril formation in AD (Barrachina et al. 2005). These and GAPDH was isolated by gel electrophoresis and results indicate that altered transcription of APP isoforms purified using the QIAquick Gel Extraction kit in AD is associated with Aβ peptides and contribute to (Qiagen, Valencia, CA), and re-amplified. Direct sequen- Aβ deposition in AD. cing of the amplified standards confirmed that the Relative quantitative real-time PCR (qPCR) uses a stan- proper sequence had been amplified (Macrogen, dard curve in which unknown concentrations of RNA or Korea). The weight/volume concentration of the stan- cDNA are used as references for the curve. Since result- dard samples was determined by spectrometry, and ing values are arbitrary and unit-less, they can only be converted to standard copy number/volume by divid- compared between samples for gene or isoform ing by the molecular weight and multiplying by Avoga- expression, but not for same-sample measurement of dro’s number. A standard curve with known standard different genes or isoforms. Therefore, an absolute quan- copy numbers for each isoform was made by serial titative method was required for measuring transcript dilution. The cDNA standards for APP770, APP751, copy number for each APP isoform. Absolute quanti- APP695, and GAPDH are 261, 193, 143, and 202-bp tation was achieved by absolute quantitative real-time long, respectively (Table 1). PCR (AQ-PCR), in which a standard curve was created for each gene, using known concentrations of reference Animals cDNA. Once the exact transcript copy number of one isoform for one sample was obtained, it could then be The protocols used in this study were reviewed and compared to the copy number of another isoform in approved by the Animal Experimentation and Ethics the same or another sample. By AQ-PCR in a previous Committee of the Catholic University of Daegu (Gyeong- human study, we developed a set of isoform-specific san, South Korea). A total of 103 C57/BL/6 male mice absolute quantitative standards that allow for the quanti- were used in this study, with 7–10 mice in each group. fication of transcript copy numbers for human APP iso- Blood and abdominal SAT samples were obtained from forms, and examined expression patterns in brain mice sacrificed at various time points after feeding a samples from 12 patients with AD and 10 control sub- normal diet (ND) or a HFD from the age of 6 weeks jects (Tharp et al. 2012). until the age of 16, 26, 36, 47, or 77 weeks (Jeong et al. In the current study, we developed a set of PCR primers 2014; Kim et al. 2014). In addition, blood and tissue to produce absolute quantitative standard curves for samples were collected from obese mice with increased measuring the three major APP isoforms and GAPDH in insulin sensitivity by thiazolidinedione (TZD) treatment. mice. We also designed primers and probe sets for real- Blood samples collected by cardiac puncture from sacri- time PCR in conjunction with our isoform-specific stan- ficed mice were centrifuged at 2400 × g for 15 min at 4°C, dards to measure APP isoform transcript levels in mouse and the plasma obtained was additionally centrifuged at adipose tissue. We measured transcript copy number for 12,500 × g for 15 min. Non-fasting plasma concentrations each APP isoform and analyzed whether the expression of glucose and insulin were measured by glucometer levels were altered by long-term high-fat diet (HFD) and enzyme-linked immunosorbent assay (ALPCO Diag- feeding, and correlated these values with indices of nostic, Salem, NH), respectively (Jeong et al. 2014; Kim glucose metabolism and insulin sensitivity. et al. 2014). 102 H. MIN ET AL. Table 1. Primer sequences for amplifying cDNA standards for absolute quantitative real-time PCR. a a Reference sequence Amplicon size (bp) Forward primer sequence Reverse primer sequence APP770 NM_001198823 261 ccattcttttacggcggatgt ctttgggttgacacgctg APP751 NM_001198824 193 agtccgtggaggaggtggtc gctgtcgtgggaaacacgct APP695 NM_007471 143 aggtggtccgagttccca gataacggccttcttgtcag GAPDH NM_001289726 202 aatgtgtccgtcgtggatc Tgtcattgagagcaatgccag ′ ′ All sequences are listed from 5 to 3 . normal distribution (Lee et al. 2003). Simple linear Extraction of RNA and preparation of cDNA from regression was used to determine relationships tissue samples between gene expression and metabolic parameters. A RNA was extracted from SAT samples, using the RNeasy p-value less than .05 was considered significant. Data Lipid Tissue Mini kit (Qiagen). During the extraction, RNA are presented as mean ± STDEV, except where noted. was treated with DNase I (Qiagen) to minimize poten- tially contaminating genomic DNA. A cDNA library was made using the High Capacity cDNA Reverse Transcrip- Results tion kit (Applied Biosystems, Foster City, CA) from 1 μg Increased expression of each of the APP isoforms total RNA, according to manufacturer’s instructions. in SAT of mice fed HFD Using relative real-time PCR (qPCR) with synthesized cDNA, the gene expression levels of IL-6, TNFα, and Absolute quantitative standards for each APP isoform CCL2 in SAT were measured and normalized to that of transcript and GAPDH amplified with high fidelity and GAPDH (Jeong et al. 2014). reproducibility; mean r for standard curves of all APP isoforms and GAPDH were greater than 0.99 (please see supplemental Figure S3). Applying AQ-PCR with an Absolute quantitative real-time PCR absolute standard curve, mRNA expression level of each APP isoform was measured in abdominal SAT Custom TaqMan gene expression assays for AQ-PCR obtained from mice fed either an ND or HFD from the were designed specifically for each APP isoform and age of 6 weeks until the age of 16, 26, 36, 47, or 77 GAPDH (Table 2, Figure 1; please also see supplemental weeks. Transcript copy number of each APP isoform in Figure S1), and ordered from Applied Biosystems ® ® each sample was normalized by the value for GAPDH, (Applied Biosystems Custom Primers & TaqMan and then presented as an absolute copy number per Probes). AQ-PCR was carried out using amplified stan- 1000 copies of GAPDH. Transcript levels of all three dards and custom TaqMan gene expression assays on major APP isoforms (APP770, APP 751, and APP695) in a StepOne Plus Real-Time PCR System (Applied Bio- SAT were significantly increased in almost all HFD systems; please see supplemental Figure S2). The groups compared to that in age-matched ND mice 20 μl reaction mixture included a cDNA template corre- (Figure 2). sponding to 20 ng of the original total RNA. While running the polymerization reaction, the real-time PCR system measured the cycle threshold values for each Increasing APP transcript levels in SAT correlate standard sample, and created a standard curve for with adipokine expression and plasma insulin each isoform by plotting cycle threshold values versus levels the log value of the transcript copy number. Using the regression equations calculated by the system soft- Linear regression analysis was carried out to determine ware, the transcript copy number for each isoform in the relationship between expression levels of each APP each unknown sample was calculated. Each was nor- isoform in SAT and body weight, plasma insulin concen- malized by the value for GAPDH and then presented tration, and expression levels of adipokines (IL-6, TNFα, as an absolute copy number per 1000 copies of CCL2) in SAT. Results showed that total transcript copy GAPDH transcript. numbers of all three major APP isoforms (APP770 + APP751 + APP695) were significantly correlated with body weight (R = 0.434, p < .001) and SAT gene Statistical analyses expression levels of TNFα, IL-6, and CCL2 (R = 0.325, p Expression levels of APP isoform transcripts were ana- < .01; R = 0.34, p < .01; and R = 0.655, p < .001, respect- lyzed by unpaired, two-tailed Student’s t-test. Plasma ively). Increasing transcript copy number of each insulin concentrations and adipokine expression levels APP770 and APP695 also significantly correlated with were log transformed when necessary to achieve a higher non-fasting plasma insulin concentrations (R = ANIMAL CELLS AND SYSTEMS 103 Table 2. Sequences of primer and probe of custom TaqMan gene expression assays for absolute quantification real-time PCR. a a a Assay Amplicon size Forward primer sequence Reverse primer sequence Probe sequence APP770 92bp agtccgtggaggaggtggtc tgtcgtgggaagtttatcag ttgacacggaagagtactg APP751 93bp ccattcttttacggcggatgt tgtcgtgggaaacacgctg ttgacacggaagagtactg APP695 131bp aggtggtccgagttccca tcggtgcttggcttccag acgagaacgagcatgc GAPDH 110bp ttgtcagcaatgcatcctgc agtgatggcatggactgtgg cctgccaagtatgatgac ′ ′ All sequences are listed from 5 to 3 . 0.462, p < .001 and R = 0.419, p < .001, respectively, (APP-KPI/APP695) was the lowest in mice fed a HFD Figure 3(A) and (C)) and gene expression levels of CCL2 until the age of 77 weeks (1.99 ± 0.3, Table 3). In addition, linear regression analysis showed that the (R = 0.667, p < .001 and R = 0.595, p < .001, respectively, Figure 3(B) and (D)). These associations suggest that ratios of transcript copy number of APP770 or APP-KPI to diet-induced obesity increased SAT expression of APP that of APP695 were correlated with plasma glucose con- centration (R = 0.314, p < .01 and R = 0.323, p < .01, isoforms, which is associated with increased levels of insulin and adipokines, which may result in developing respectively, Figure 4). systemic metabolic abnormalities. Change in transcript copy number of APP770 in Ratios of APP isoforms in SAT were altered in SAT of TZD-treated obese mice obesity and aging and correlated with plasma By AQ-PCR, transcript copy numbers of APP isoforms glucose levels were measured in SAT from mice treated with TZD (n = 10) or vehicle (n = 8). In the TZD-treated mice, Since APP alternative splicing and isoform ratios have APP770 copy number was significantly decreased in been shown to play a role in the development of Aβ SAT compared to control mice treated with vehicle plaques and AD (Tharp et al. 2012; Alam et al. 2014; only (230.7 ± 64.0 vs. 140.6 ± 43.7, p < .01, Figure 5). Love et al. 2015), we analyzed the expression ratios of APP751 tended to be decreased in TZD-treated mice, APP isoforms in SAT. Results showed that APP695 but the difference was not statistically significant. expression in SAT was significantly increased with However, no differences were found in APP695 copy aging in both mice groups of ND (77 vs. 47 weeks, numbers between two mice groups. These data 96.2 ± 38.4 vs. 35.4 ± 17.5, p < .001) and HFD (77 vs. 47 suggest that TZD treatment affects KPI-containing per- weeks, 213.1 ± 48.5 vs. 68.9 ± 31.8, p < .001, Figure 2 ipheral-type APP isoforms but not the central-type APP and Table 3). Therefore, the ratios of transcript copy isoform. number of KPI-containing isoforms (APP-KPI, APP770 + APP751) to that of APP695 were gradually decreased with aging after the age of 26 weeks (Table 3). Since Discussion APP695 expression in SAT was significantly increased by HFD feeding in all age groups (p <.05, Figure 2) and In this study, AQ-PCR was developed for measuring tran- dramatically increased in mice at 77 weeks of age com- script copy numbers of three major APP isoforms. By pared to younger mice (p < .001, Figure 2), the ratio using a standard curve sample in copy number/volume Figure 1. Schematic diagram showing the positions of primers (solid arrows) for standard curves samples, and primers (dashed arrows) and probes (dotted bars) for AQ-PCR for each APP isoform and GAPDH. (A) APP770, (B) APP751, (C) APP695, (D) GAPDH. 104 H. MIN ET AL. symptoms and severity of cognitive loss in AD patients, suggesting the possibility that abnormal APP processing in the brain may be reflected in the periphery, thus suggesting it could serve as a diagnostic marker (Bush & Tanzi 1998; Di Luca et al. 1998). Altered APP expression levels and aberrant processing was also observed in lymphoblastoid cells from subjects with familial AD, in parallel with increased expression of proinflammatory cytokines (Matsumoto & Fujiwara 1993). These data are similar to our previous observation that APP was increased in adipocytes/adipose tissue of obese individuals and mice and was correlated with gene expression profiles of proinflammatory cytokines (Lee et al. 2008; Jeong et al. 2014). In the current study, using a refined method for absolute quantitative analysis of the three major APP isoforms, we found significantly increased expression for all of three major APP isoforms in SAT of HFD-induced obese mice compared to age- matched control mice fed a ND. Expression levels of each isoform were correlated with adipokine expression and plasma levels of glucose. Collectively, these data suggest that peripheral changes in APP expression may be related to the progression of AD and inflammation and glucose metabolism in the periphery. Further examination of isoform expression showed increased expression of the neuronal type APP isoform (APP695) in SAT of older mice fed either a ND or HFD, resulting in a decreasing ratio of APP-KPI to APP695 with aging. Therefore, the ratio (APP-KPI/APP695) was the lowest in 77-week-old mice. As documented pre- viously (Karambataki et al. 2014), APP alternative splicing can be influenced by both the aging process and/or Figure 2. Transcript copy number of APP770 (A), APP751 (B), and environmental factors, such as a HFD or obesity. By treat- APP695 (C) per 1000 mRNA transcript copies of GAPDH in SAT of ing TZD to HFD-induced obese and insulin-resistant C57BL/6 mice fed either a ND or HFD until 16, 26, 36, 47, or 77 mice, we found that APP770 copy number was signifi- weeks of age. *p < .05, **p < .01, ***p < .001 between mice on cantly decreased in SAT compared to control mice ND and HFD. treated with vehicle only, whereas no differences were found in APP695 copy numbers between the two mice concentration for each APP isoform, the expression level groups. In addition, linear regression analysis showed of each of APP isoform in mouse SAT was quantified and that the ratios of transcript copy number of APP770 or normalized to that of GAPDH, and then presented as an APP-KPI to that of APP695 correlated with plasma absolute copy number per 1000 copies of GAPDH. glucose concentration, suggesting that altered ratios of Although a great deal is known about neural APP and APP isoforms were related to systemic glucose metab- Aβ, APP is also widely expressed in peripheral tissues olism and insulin sensitivity. These results suggest that from skin, intestinal epithelia, and skeletal muscle, as not only APP expression but also expression ratios of well as leukocytes, platelets, pancreas, and adipose APP isoforms in peripheral tissues may be related to tissue (Joachim et al. 1989; Bush et al. 1990; Kuo et al. aging and glucose metabolism and insulin sensitivity in 2000; Hansel et al. 2003; Lee et al. 2008). However, the the entire body and in the periphery. function and regulation of peripheral APP is not yet Enzyme secretases have been known to have impor- fully understood. tant roles in APP processing to Aβ and in AD pathogen- Several studies have demonstrated altered APP esis. In our previous studies, we have demonstrated that isoform ratios in platelets of AD patients and a corre- secretases were expressed in adipose tissue. Although lation of platelet isoforms with the progression of clinical most of secretase genes were not differentially ANIMAL CELLS AND SYSTEMS 105 Figure 3. Transcript copy number of APP770 and APP695 (per 1000 mRNA transcript of GAPDH) in SAT correlated with non-fasting plasma insulin levels (A and C) and log expression level of CCL2 in SAT (B and D) of C57BL/6 mice fed either a ND or HFD until the age of 16, 26, 36, 47, or 77 weeks. expressed with obesity, those expression data imply that role in this process (Love et al. 2015). Our results the adipocyte/adipose tissue is equipped with the requi- suggest that HFD feeding and obesity is likely to alter site enzymatic machinery for processing APP to its APP alternative splicing, which could be affected by pathogenic cleavage products, Aβ40 and Aβ42 (Lee trans-acting factors. Elucidating the mechanism of APP et al. 2008; Tharp et al. 2016). Additionally, in this alternative splicing in adipose tissue with obesity and study, mRNA expression levels of β-secretase-1 (BACE1), the exact role that alternative splicing events play in a representative secretase, were measured by relative enhancing the production of Aβ could contribute to qPCR to see the effect of long-term HFD feeding. The the development of new drug targets for preventing results did not show a noteworthy feature and are con- obese-related AD and other complications of obesity. sistent to our previous BACE1 expression data in In summary, this study developed an absolute quanti- human adipose tissue (supplemental Figure S4). fication method to measure absolute copy numbers of The presence of cis-elements and the tissue-specific major APP isoforms, and demonstrated that APP iso- expression of trans-acting factors, such as the RNA- forms were increased in mouse adipose tissue with binding protein fork head box for APP (RBFox) (Alam obesity and the ratios of APP isoforms were altered et al. 2014), regulate overall alternative splicing patterns with aging. In addition, isoform expressions were corre- (Qian & Liu 2014; Stilling et al. 2014). There is still little lated with in vivo measures of glucose metabolism and known about factors contributing to the alternative spli- a proinflammatory pattern of adipokine expression in cing of the APP gene in obesity and aging, and further adipose tissue. We demonstrated that treatment of research is needed to examine if RBFox proteins play a insulin sensitizer could reduce the increased expression Table 3. Ratios of transcript copy number of KPI-containing isoforms (APP-KPI, APP770 + APP751) to that of APP695. Age at sacrifice (weeks) Ratio Diet 16 26 36 47 77 (APP770 + APP751)/APP695 ND 4.61 ± 1.0 7.21 ± 1.8 5.99 ± 1.4 5.22 ± 1.7 2.68 ± 0.2 HFD 4.88 ± 0.9 6.63 ± 1.4 4.95 ± 1.4 4.43 ± 1.3 1.99 ± 0.3 106 H. MIN ET AL. experiments and across studies conducted by indepen- dent research groups. Understanding the biology and the potential importance of peripheral tissues of APP regulation and the expression of specific isoforms is criti- cal to unraveling the pathology of APP-related abnorm- alities, such as AD. Finally, the relationship between adipose tissue expression of APP and Aβ peptides and risk for AD are not well known, and will require long- term studies to address. Disclosure statement No potential conflict of interest was reported by the authors. Funding This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education [NRF- 2013R1A1A2013653], and the ‘Advanced Medical Material (Fiber) Development Program’ through the Ministry of Knowl- edge Economy (MKE) and the Korea Institute for Advancement of Technology (KIAT). References Figure 4. Correlation of non-fasting plasma glucose levels with Alam S, Suzuki H, Tsukahara T. 2014. Alternative splicing regu- ratios of transcript copy number of APP770 (A) and APP-KPI (B) lation of APP exon 7 by RBFox proteins. Neurochem Int. to that of APP695 in SAT of C57BL/6 mice fed either a ND or 78:7–17. HFD until 16, 26, 36, 47, or 77 weeks of age. Barrachina M, Dalfo E, Puig B, Vidal N, Freixes M, Castano E, Ferrer I. 2005. Amyloid-beta deposition in the cerebral of the APP770 isoform. To our knowledge, this study is cortex in dementia with Lewy bodies is accompanied by a relative increase in AbetaPP mRNA isoforms containing the the first to measure the absolute copy number of APP Kunitz protease inhibitor. Neurochem Int. 46:253–260. isoforms in adipose tissue by AQ-PCR. The method pre- Bush AI, Martins RN, Rumble B, Moir R, Fuller S, Milward E, Currie sented is simple, and accurately compares expression J, Ames D, Weidemann A, Fischer P, et al. 1990. The amyloid levels of each APP isoform from the same sample. It precursor protein of Alzheimer’s disease is released by can be implemented in a standardized fashion, allowing human platelets. J Biol Chem. 265:15977–15983. Bush AI, Tanzi RE. 1998. Alzheimer disease-related abnormal- APP isoform expression data to be compared between ities of amyloid beta precursor protein isoforms in the plate- let: the brain’s delegate in the periphery? Arch Neurol. 55:1179–1180. Di Luca M, Pastorino L, Bianchetti A, Perez J, Vignolo LA, Lenzi GL, Trabucchi M, Cattabeni F, Padovani A. 1998. Differential level of platelet amyloid beta precursor protein isoforms: an early marker for Alzheimer disease. Arch Neurol. 55:1195–1200. Hansel DE, Rahman A, Wehner S, Herzog V, Yeo CJ, Maitra A. 2003. Increased expression and processing of the Alzheimer amyloid precursor protein in pancreatic cancer may influence cellular proliferation. Cancer Res. 63:7032– Hardy J, Selkoe DJ. 2002. The amyloid hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics. Figure 5. Transcript copy number of APP isoforms (per 1000 Science. 297:353–356. transcript copies of GAPDH) in SAT from TZD treated mice Jeong JI, Kim J, Kim KM, Choi I, Pratley RE, Lee YH. 2014. Altered (closed bars) and control mice treated with vehicle only (open gene expression of amyloid precursor protein in the adipose bars). **p < .01. tissue and brain of obese mice fed with long-term high-fat ANIMAL CELLS AND SYSTEMS 107 diet and streptozotocin-induced diabetic mice. Anim Cells Ling Y, Morgan K, Kalsheker N. 2003. Amyloid precursor Syst. 18:219–227. protein (APP) and the biology of proteolytic processing: rel- Joachim CL, Mori H, Selkoe DJ. 1989. Amyloid beta-protein evance to Alzheimer’s disease. Int J Biochem Cell Biol. deposition in tissues other than brain in Alzheimer’s 35:1505–1535. disease. Nature. 341:226–230. Love JE, Hayden EJ, Rohn TT. 2015. Alternative splicing in Karambataki M, Malousi A, Kouidou S. 2014. Risk-associated Alzheimer’s disease. J Parkinsons Dis Alzheimers Dis. 26. coding synonymous SNPs in type 2 diabetes and neurode- doi:10.13188/2376-922X.1000010 generative diseases: genetic silence and the underrated Matsui T, Ingelsson M, Fukumoto H, Ramasamy K, Kowa H, association with splicing regulation and epigenetics. Mutat Frosch MP, Irizarry MC, Hyman BT. 2007. Expression of APP Res. 770:85–93. pathway mRNAs and proteins in Alzheimer’s disease. Brain Kim J, Jeong JI, Kim KM, Choi I, Pratley RE, Lee YH. 2014. Res. 1161:116–123. Improved glucose tolerance with restored expression of Matsumoto A, Fujiwara Y. 1993. Aberrant proteolysis of the glucose transporter 4 in C57BL/6 mice after a long period beta-amyloid precursor protein in familial Alzheimer’s of high-fat diet feeding. Anim Cells Syst. 18:197–203. disease lymphoblastoid cells. Eur J Biochem. 217:21–27. Kuo YM, Kokjohn TA, Watson MD, Woods AS, Cotter RJ, Sue LI, Nair S, Lee YH, Rousseau E, Cam M, Tataranni PA, Baier LJ, Kalback WM, Emmerling MR, Beach TG, Roher AE. 2000. Bogardus C, Permana PA. 2005. Increased expression of Elevated abeta42 in skeletal muscle of Alzheimer disease inflammation-related genes in cultured preadipocytes/ patients suggests peripheral alterations of AbetaPP metab- stromal vascular cells from obese compared with non- olism. Am J Pathol. 156:797–805. obese pima Indians. Diabetologia. 48:1784–1788. Lee YH, Martin JM, Maple RL, Tharp WG, Pratley RE. 2009. Qian W, Liu F. 2014. Regulation of alternative splicing of tau Plasma amyloid-beta peptide levels correlate with adipocyte exon 10. Neurosci Bull. 30:367–377. amyloid precursor protein gene expression in obese individ- Stilling RM, Benito E, Gertig M, Barth J, Capece V, Burkhardt S, uals. Neuroendocrinology. 90:383–390. Bonn S, Fischer A. 2014. De-regulation of gene expression Lee YH, Nair S, Rousseau E, Allison DB, Page GP, Tataranni PA, and alternative splicing affects distinct cellular pathways in Bogardus C, Permana PA. 2005. Microarray profiling of iso- the aging hippocampus. Front Cell Neurosci. 8:373. doi:10. lated abdominal subcutaneous adipocytes from obese vs 3389/fncel.2014.00373 non-obese pima Indians: increased expression of inflam- Tharp WG, Gupta D, Smith J, Jones KP, Jones AM, Pratley RE. mation-related genes. Diabetologia. 48:1776–1783. 2016. Effects of glucose and insulin on secretion of amyloid- Lee YH, Tharp WG, Maple RL, Nair S, Permana PA, Pratley RE. beta by human adipose tissue cells. Obesity. 24:1471–1479. 2008. Amyloid precursor protein expression is upregulated Tharp WG, Lee YH, Greene SM, Vincellete E, Beach TG, Pratley RE. in adipocytes in obesity. Obesity. 16:1493–1500. 2012. Measurement of altered AbetaPP isoform expression in Lee YH, Tokraks S, Pratley RE, Bogardus C, Permana PA. 2003. frontal cortex of patients with Alzheimer’s disease by absolute Identification of differentially expressed genes in skeletal quantification real-time PCR. J Alzheimers Dis. 29:449–457. muscle of non-diabetic insulin-resistant and insulin-sensitive Zhao YJ, Han HZ, Liang Y, Shi CZ, Zhu QC, Yang J. 2015. pima Indians by differential display PCR. Diabetologia. Alternative splicing of VEGFA, APP and NUMB genes in color- 46:1567–1575. ectal cancer. World J Gastroenterol. 21:6550–6560.
http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png
Animal Cells and Systems
Taylor & Francis
http://www.deepdyve.com/lp/taylor-francis/measurement-of-altered-app-isoform-expression-in-adipose-tissue-of-6PjW0gqLWo
