Abstract
MOLECULAR & CELLULAR BIOLOGY Animal Cells and Systems Vol. 16, No. 6, December 2012, 455461 Overexpression and purification of recombinant lysozyme from Agrius convolvuli expressed as inclusion body in Escherichia coli Soon-Ik Park and Sung Moon Yoe* Department of Biological Sciences, Dankook University, Cheonan 330-714, Korea (Received 5 March 2012; received in revised form 14 June 2012; accepted 19 June 2012) Amongst the various antimicrobial peptides, lysozyme plays a central role in initiating and maintaining the antibacterial defense response of insect. Here we propose the biosynthesis and refolding of recombinant lysozyme in Escherichia coli expressed in inclusion body form. The Agrius lysozyme gene was amplified using gene specific primers and then ligated into the pGEX-4T-1 vector, which contained the glutathione S-transferase (GST) gene as a fusion partner. A recombinant lysozyme was expressed in E. coli Rosetta cells using a pGEX-4T-1 expression vector, and the fusion protein was induced by ioporpyl-b-D-thiogalactopyranoside (IPTG). The recombinant protein produced as an inclusion body was resolubilized in solubilization buffer, and the resultant solution was dialyzed in refolding buffer. After thrombin cleavage, the recombinant lysozyme was purified by ion exchange chromatography and reverse phase chromatography. The recombinant lysozyme was subjected to sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) analysis and immunoreactivity against the anti-Agrius lysozyme was observed by western blot analysis of this protein. The recombinant lysozyme displayed antibacterial activity against Bacillus megaterium and Micrococcus luteus, which was confirmed by the inhibition zone assay. Keywords: lysozyme; Agrius convolvuli; inclusion body; expression; refolding Introduction as a model protein. The recombinant Agrius convolvuli lysozyme (ACLyz), which was expressed as IB in Lysozymes play an important role in protecting against E. coli, was solubilized, refolded by a chaotropic reagent, exterior bacteria. It is also known as muramidase or dialyzed, and subjected to on-column refolding. Puri- N-acetylmuramide glycanhydrolase, attacking and fication of the bioactive recombinant protein was damaging bacterial cell walls by catalyzing the hydrolysis accomplished by cation exchange and reverse-phase of the 1,4-b-linkages between N-acetylmuramic acid chromatography. and N-acetyl-D-glucosamine residues in a peptidoglycan and between N-acetyl-D-glucosamine residues (Ganz 2002). It has been found in many kinds of vertebrates, Materials and methods invertebrates, plants, and micro-organisms since its Insect, bacterial strains, and plasmid initial discovery in the 1920s. Insect lysozymes have been cloned and overexpressed in Escherichia coli. Agrius convolvuli were supplied from the Rural Devel- Recently, the c-type lysozyme has been cloned from opment Administration, Suwon, Korea, and the total some lepidopterans, including Spodoptera litura (Kim RNA was obtained from the fifth instar larvae to clone and Yoe 2009). the lysozyme gene. Larvae were infected with E. coli Expression systems using prokaryotic cells are the K12 D21 to induce an immune response. Fat bodies were dissected 24 h after immunization, and stored most widely used systems for the production of at 808C for RNA extraction. The E. coli JM109 recombinant protein (Hanning and Makrides 1998). (Progmega) and pGEX-4T-1 vector (Pharmacia) were Many recombinant proteins expressed in E. coli tend to used for cloning and the E. coli Rosetta singles strain aggregate and form inclusion bodies (IB). IB formation (Novagen) was used for expression studies. is mainly due to limited solubility and the lack of appropriate chaperone systems in the prokaryotic host. As suggested by Thatcher and Hitchcock (1994), Cloning of ACLyz cDNA by RACE-PCR purifying IB may be advantageous in reducing the impurities load on subsequent protein purification. The total RNA was prepared from immunized fat Many industrial processes make use of these protein bodies using TRIzol reagent (Invitrogen). A DNA aggregates, though this strategy requires solubilization fragment was prepared by reverse transcription PCR and renaturation of the product. with first strand cDNA from immunized fat body, In the present work, we reported the purification using degenerate primers designed based on the amino and refolding study of IB using an insect lysozyme acid sequence of lysozyme from Hyalophora cecropia *Corresponding author. Email: smyoe@dankook.ac.kr ISSN 1976-8354 print/ISSN 2151-2485 online # 2012 Korean Society for Integrative Biology http://dx.doi.org/10.1080/19768354.2012.706638 http://www.tandfonline.com 456 S.-I. Park and S.M. Yoe (GenBank accession no. M60914) and Manduca sexta and NUP for sense primer, gene specific anti-sense (S70589). The ACLyz gene was amplified by RACE- primer 1 (5?-ACAGTGGTTGCGCCAACCATACC-3?), PCR using a SMART RACE cDNA amplification kit andgenespecificanti-senseprimer 2 (5?-GCGTTT- (Clontech). To generate a 3? RACE-Ready first-strand GTAAATCTTCTTGGCGCA-3?). 5? RACE PCR was carried out under the following conditions: preheating cDNA, we used primer termed 3?-CDS primer (5?- for 5 min at 958C, 30 cycles (958C for 30 sec, 638Cfor AAGCAGTGGTATCAACGCAGAGTACT VN-3?). 45 sec, and 728C for 30 sec) and for 3 min at 728C. The 3? RACE PCR was carried out for 35 cycles with PCR products were cloned into the pGEM T-easy vector denaturation of 30 sec at 958C, annealing of 30 sec at (Promega). 598C, and extension of 45 sec at 728C with a final extension of 5 min at 728C. Degenerate sense primer 1 (5?-GTTRGTRCAKGAGCTKAGRAGACWAGGC- Construction of expression plasmid for the lysozyme 3?), degenerate sense primer 2 (5?-ATGAGKRAYTG- GGTSTGCCTYSGAG-3?), Universal Primer A Mix The ACLyz was isolated and the ACLyz cDNA was (UPM), and Nested Universal Primer (NUP: 5?- amplified (Kim and Yoe 2003). The coding region of AAGCAGTGGTATCAACGCAGAGT-3?) were used the ACLyz gene was amplified by PCR using primers for anti-sense primer. UPM was mixed with 0.4 mMof ACLyz BamHI 5?-CCGGGATCCAAGCATTTCAG- long form (5?-CTAATACGACTCACTATAGGG- CAGATGT-3? and ACLyz XhoI5?-CCGCTCGAGT- CAAGCAG TGGTATCAACGCAGAGT-3?) and 2.0 TAGCAGGAGCTGATATCAG-3?. The pGEX-4T-1 mM of short form (5?-CTAATACGACTCACTA- plasmid was cut with BamHI and XhoI restriction TAGGGC-3?). 5? RACE-Ready cDNA was prepared enzymes (Roche), and the PCR product, which was cut from 1 mg total RNA of the fat body and ligated with with the same enzymes, was inserted between the SMART II A oligo (5?-AAGCAGTGGTATCAACG- restriction sites to construct the ACLyz-pGEX-4T-1 CAGAGTACGCGGG-3?) and 5?-CDS primer (5?- expression vector (Figure 1). The plasmid was screened T VN-3?). The cDNA was amplified with a UPM in JM109 by transformation. Finally, the sequence of Figure 1. The nucleotide sequence and construction of the expression plasmid. (A) Design of expression primers for ACLys. (B) Cloning strategy used to place the ACLys gene into the expression vector. pGEX-4T1 vector and the amplified lysozyme gene fragment were digested with both BamHI and XhoI, ligated to produce the GST-AClyz fusion protein, and transformed into E. coli JM109 and Rosetta singles. Animal Cells and Systems 457 ACLyz-pGEX-4T-1 was confirmed by PCR and DNA proteins were applied to a Resource RPC (GE health- sequencing. care) column equilibrated with 8 M urea and, followed by three column volumes of 8 M urea. The column containing denatured proteins was eluted with a linear Overexpression of recombinant lysozyme gradient of 1090% acetonitrile in 0.1% aqueous Escherichia coli Rosetta singles strain was transformed trifluoroacetic acid (TFA). with the recombinant plasmid and a single colony grown for 12 h in Luria-Bertani (LB) medium with Electrophoresis and western blot analysis 100 mg/ml ampicillin at 378C with shaking at 200 rpm Sodium dodecyl sulfate-polyacrylamide gel electro- was used for innoculation. When the optical density phoresis (SDS-PAGE) was carried out in a 12.5% reached 0.3 at 600 nm, the recombinant lysozyme polyacrylamide gel. After electrophoresis, the gel was overexpression was induced by adding ioporpyl-b-D- stained with Coomassie brilliant blue R250. Western thiogalactopyranoside (IPTG) to a final concentration blot analysis was performed as previously described of 0.3 mM and the solution was incubated for 3 h at using a rat polycolonal anti-lysozyme antibody (Kim 258C. and Yoe 2008) and goat anti-GST antibody. The protein concentration at each purification step was Disruption and preparation of IB determined by the bicinchonic acid (BCA) assay according to the manufacturer’s specifications using The cells were harvested by centrifugation at 4000 g for bovine serum albumin as the standard (Stoscheck 20 min at 48C. The pellets were resuspended in 1/20 1990). culture volume of phosphate-buffer saline (PBS, pH 7.4) containing 1% Triton X-100 at 48C and sonicated three times for 15 sec each time. After centrifugation at Assay of antibacterial activity 25,000 g for 15 min at 48C, the IB were washed twice Antibacterial activities of recombinant ACLyz were with 2 M urea mixing with intermittent sonication at measured using the inhibition zone assay (Kim, Park, 48C. The isolated IB were stored at 208C. et al. 2011). Each of the 1% agarose plates containing 7 mgof Micrococcus luteus powder (Sigam) and 6 10 cells/ml of Bacillus megaterium was prepared and wells Solubilization, refolding, and thrombin cleavage of the recombinant protein that were 3 mm in diameter were punched out of the plates. The antimicrobial activity of an aliquot of each The IB were dissolved in a solubilization buffer fast protein liquid chromatography [FPLC] fraction containing 8 M urea for 12 h at room temperature against Gram-positive strains (B. megaterium and M. with shaking and the insoluble material was removed luteus) was examined. After overnight incubation at by centrifugation at 25,000 g for 15 min at 48C. The 378C, the diameter of the clear zones was recorded. supernatant was dialyzed overnight against 1 M urea. After dialysis, 100 mg of GST-ACLyz (glutathione S transferase-recombinant ACLyz) fusion protein per 1 Results unit thrombin (Sigma) was added to cleave the Recombinant plasmid construction glutathione S-transferase (GST) from the recombinant ACLyz and incubated for 8 h at room temperature. The full-length nucleotide sequence was obtained by RACE-PCR using total RNA from the A. convolvuli fat bodies. Deduced amino acids are indicated by single- Purification of recombinant lysozyme letter code below the sequence. The ACLyz gene was The cleaved proteins were denatured by adding six amplified with primers ACLyz BamHI and ACLyz volumes of denaturing buffer containing 8 M urea with XhoI (Figure 1A). The amplified ACLyz gene was 100 mM b-mercaptoethanol (b-MET) and loaded onto inserted into the pGEX-4T-1 vector. E. coli JM109 Resource S (GE healthcare) column equilibrated with 8 and BL21 were transformed with the recombinant M urea. The bound proteins were eluted using a linear plasmid for the library and overexpression as shown gradient starting with an elution buffer containing 8 M in Figure 1B. urea and ending with 10 mM TrisHCl, 1 M NaCl, 1 mM GSH, 0.1 mM GSSG in 1 M urea, pH 9.0. The Overexpression of recombinant fusion protein fractions containing the eluted proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electro- Overexpression of the recombinant lysozyme was phoresis (SDS-PAGE) and then denatured by adding induced by adding 0.3 mM IPTG for 3 h at 258C. six volumes of the denaturing buffer. The denatured Because most of the recombinant fusion proteins were 458 S.-I. Park and S.M. Yoe expressed in IB, a high level of IB was observed in the six volumes of denaturing buffer and then the dena- E. coli Rosetta singles transformed with the recombi- turant was loaded onto a Resource RPC column for nant plasmid (Figure 2B). SDS-PAGE analysis re- final purification. The recombinant ACLyz was pur- vealed that the purified recombinant protein was ified in the fraction numbers 14 and 15 (Figure 3C, D), approximately 42 kDa (Figure 2C, lane 1). The GST- which had bacteriolytic and antibacterial activities ACLyz fusion protein was confirmed by western (Figure 4). The recombinant and wilde-type lysozyme blotting using an anti-ACLyz antibody and anti-GST did not have antibacterial activity against E. coli k12 (Figure 2A, B). (data not shown). Solubilization of IB and thrombin cleavage of Discussion GST-ACLyz The ACLyz is a single-chain polypeptide of 120 amino The cells were disrupted using a sonic disintegrator as acids that is cross-linked through four disulfide bridges. described above. Following disruption, the IB were The DNA fragment containing the mature ACLyz recovered by centrifugation and washed with 2 M urea. sequence was generated by PCR using A. convolvuli The IB were solubilized in 8 M urea and dialyzed cDNA as template and cloned at the BamHI and XhoI against 1 M urea and, subsequently, treated with sites of the pGEX-4T-1 vector. The recombinant thrombin for 12 h at 258C to cleave GST from the plasmid was sequenced and proven to be correct. To recombinant ACLyz (Figure 2C). After dialysis of improve the recombinant protein yield, the Rosetta the inclusion body, SDS-PAGE sample buffer (without singles strain was used for the expression of recombi- b-MET) was used to verify the formation of the nant ACLyz (Figure 1). The Rosetta (DE3) singles appropriate disulfide bond. The top band corresponds strain, which provides tRNAs for six rare codons, was to aggregates of ACLyz, GST, and GST-ACLyz designed to enhance the expression of eukaryotic (Figure 2C, lane 3). proteins containing codons rarely used in E. coli (Fan et al. 2009). Soluble recombinant proteins are often properly Purification of recombinant bioactive ACLyz folded, functional, and easier to purify than aggregated As described above, the solubilized cleaved proteins proteins from IB (Galloway et al. 2003). A general way were loaded into a Resource S column for on-column to reduce protein aggregation due to self-association of refolding, and the SDS-PAGE result showed that nascent proteins is to reduce the rate of protein ACLyz (15 kDa) and GST-ACLyz (42 kDa) were synthesis in E. coli by applying lower growth tempera- preparatively purified (Figure 3A, B). The ion ex- tures. Other parameters that may influence protein change purification products were denatured by adding solubility include culture medium, time of induction, Figure 2. Identification of recombinant ACLyz expressed in an inclusion body form and treatment with thrombin. (A) Western blot analysis of the fused protein using an anti-lysozyme antibody. M, protein marker; lane 1, total cell; lane 2, inclusion body; lane 3, wild-type ACLyz. (B) Western blot analysis of the fused protein using the anti-GST antibody. M, protein marker; lane 1, total cell; lane 2, inclusion body; lane 3, supernatant (soluble fraction). (C) SDS-PAGE analysis of IB and cleavage of fused protein with thrombin. M, protein marker; lane 1, dialyzed inclusion body with 1M urea; lane 2, GST-ACLyz cleaved with thrombin; lane 3, the same as lane 2 without b-MET. Animal Cells and Systems 459 Figure 3. Purification of bioactive recombinant ACLyz. (A) Preparative purification using Resource S (A buffer, 8 M urea; B buffer, 1 M urea with 10 mM TrisHC1, 1 mM GSH, 0.1 mM GSSG, and 1 M NaCl, pH 9.0). (B) SDS-PAGE analysis of Resource S chromatography fractions. M, protein marker; lane 1, mock sample; lanes 1315, fraction numbers of Resource S (13, 14, and 15, respectively). (C) Final purification of recombinant ACLyz using Resource RPC (Binding buffer, 8 M Urea; A buffer, 0.05% TFA in 10% acetonitrile; B buffer, 0.05% TFA in 90% acetonitrile). (D) SDS-PAGE analysis of RPC fractions. M, protein marker; Ori, wilde-type ACLyz; lanes 1238, fraction numbers of RPC (1238), respectively. aeration, and E. coli strain (Berrow et al. 2006). induced E. coli cell extracts indicated that the fusion Although the E. coli Rosetta strain used to produce protein was mostly expressed as insoluble IB (Figure 2). the recombinant fusion protein was cultured at 258C Expression of recombinant ACLyz was confirmed in a under aeration conditions, the GST-ACLyz fused small-scale culture of E. coli Rosetta singles harbouring protein was expressed as inclusion body form. A the recombinant protein using LB medium. A high- high-level expression of recombinant proteins with expressor clone was used in the subsequent fermentation disulfide bonds, which was the case for ACLyz, in experiment. E. coli often results in the formation of IB due to an There are a number of benefits to expression of recombinant proteins in IB: (1) the IB are produced in unfavorable protein-folding environment (van den Berg et al. 1999). In our study, western blot and SDS-PAGE high yield although they are toxic to bacterial cells; (2) they are generally protected from proteolytic analysis of the soluble and insoluble fractions of the Figure 4. Inhibition zone assay of purified recombinant and wilde-type ACLyz against M. luteus and B. megaterium. Each well was loaded with 1 mg of purified proteins (RPC fraction numbers 14 and 15). 460 S.-I. Park and S.M. Yoe degradation, and can be easily solubilized using using the Resource RPC column, which involves chaotropic reagents or solution of alkaline pH; (3) hydrophobic interaction chromatography, to purify they can potentially be a good starting point for the recombinant ACLyz (Figure 3C). It should be noted purification of recombinant proteins since they contain that the usage of a reduced thiol reagent before column almost pure protein in different states of aggregation in injection was crucial so that the ACLyz, GST, and an inactive form (Singh and Panda 2005). Following GST-AClyz could be bound to the RPC column sonication, the lysate was removed as the soluble separately. The recombinant ACLyz was not separated proteins by centrifugation and washing with 2 M urea from GST and GST-AClyz without b-MET in final to increase the purity of the IB (Figure 2). The washing purification (data not shown). The purified recombi- steps were used to purify the IB prior to protein nant ACLyz, which had an apparent molecular weight refolding, which is strongly affected by the presence of of 15 kDa (Figure 3D), displayed antibacterial activity impurities (Batas et al. 1999). Once the IB were isolated against M. lueus and B. megaterium (Figure 4). and purified, the next step was solubilization. Eight However, the activity of recombinant ACLyz was molar urea was employed to solubilize IB. After weaker than wilde-type ACLyz. As Figure 3D shown, dialysis, the remaining impurities consisted of only fractions of the eluted protein were analyzed by SDS- three or four bands (Figure 2C, lane 1). These bands PAGE, revealing minor bands below the major band of were most likely outer membrane proteins, whose 15 kDa. It is likely that formation of these minor forms presence in IB has been previously observed (Rinas is due to codon bias problems that are highly prevalent et al. 1993). Before the on-column refolding of ACLyz, in recombinant expression systems, when heterologous the solubilized IB were dialyzed against 1 M urea to proteins containing rare codons accumulate in large ensure proper cleavage of GST from the fusion protein quantities (Kim, Yoe, et al. 2011). and to prevent denaturation of thrombin and aggrega- The full-length cDNA encoding ACLyz was cloned tion of the proteins. As shown in Figure 2C, lanes 2 and and the recombinant ACLyz was successfully produced 3, the dimeric or higher forms of the proteins were as an inclusion body using a prokaryotic system. The observed to the formation of incorrect disulfide bonds, solubilization, refolding, and purification procedures which indicated that reduced a thiol reagent, such as for recombinant ACLyz have several distinct advan- b-MET, should be used for chromatography. tages over other methods, such as simple on-column In recent years, many novel high-throughput pro- refolding and purification of IB using efficient reducing tein refolding methods have been developed for rena- agents. In addition, the results and methods developed turation of inclusion body proteins, including dilution, in this study will help to resolve several industrial dialysis, and solid-phase separation. Different dialysis challenges in regard to proteins that express in IB. and dilution methods along with the use of additives have been reported to improve the recovery of inclusion body proteins (Clark 1998; Tsumoto et al. 2003; Acknowledgements Middelberg 2004; Vallejo and Rinas 2004). Several The present research was conducted by the research fund of techniques based on the interaction between protein Dankook University in 2010. and chromatography techniques have been developed to help correct refolding and increase the refolding References yield and product purity (Li et al. 2002). In this study, we used a Resource S column for on-column refolding Batas B, Schiraldi C, Chaudhuri JB. 1999. Inclusion body purification and protein refolding using microfiltration and Resource RPC column for final purification. The and size exclusion chromatography. J Biotechnol. 68: cleaved proteins were denatured by adding six volumes 149158. of denaturing buffer and applied onto a Resource S Berrow NS, Bussow K, Coutard B, Diprose J, Ekberg M, column equilibrated with 8 M urea. The bound Folkers GE, Levy N, Lieu V, Owens RJ, Peleg Y, et al. proteins were eluted using a linear gradient of 8 M 2006. Recombinant protein expression and solubility screening in Escherichia coli: a comparative study. Acta urea and 1 M urea with 10 mM TrisHCl, 1 M NaCl, 1 Crystallogr D Biol Crystallogr. 62:1026. mM GSH, and 0.1 mM GSSG, pH 9.0 (Figure 3A). Clark ED. 1998. Refolding of recombinant proteins. Curr Proteins containing multiple disulfide bonds, such as Opin Biotechnol. 9:157163. lysozyme, which contains six cysteines, require a more Fan Z, Yue C, Tang Y, Zhang Y. 2009. Cloning, sequence elaborative refolding process in the presence of optimal analysis and expression of bacterial lipase-coding DNA fragments from environment in Escherichia coli. Mol Biol concentrations of both oxidizing and reducing agents Rep. 36:15151519. for the formation of disulfide bonds (Fischer et al. Fischer B, Sumner I, Goodenough P. 1993. Isolation, rena- 1993; Vallejo and Rinas 2004). As shown in Figure 3B, turation and formation of disulfide bonds of eukaryotic recombinant ACLyz was not purified from the inclu- proteins expressed in E. coli as inclusion bodies. Biotech- sion body. Therefore, final purification was performed nol Bioeng. 41:313. Animal Cells and Systems 461 Galloway CA, Sowden MP, Smith HC. 2003. Increasing the Li M, Zhang G, Su Z. 2002. Dual gradient ion-exchange yield of soluble recombinant protein expressed in E. coli chromatography improved refolding yield of lysozyme. by induction during late log phase. Biotechniques. 34: J Chromatogr A. 959:113120. 524526. Middelberg APJ. 2004. Preparative protein folding. Trends Ganz T. 2002. Antimicrobial polypeptides in host defense of Biotechnol. 20:433437. the respiratory tract. J Clin Invest. 109:693697. Rinas U, Boone TC, Bailey JE. 1993. Characterization of Hanning G, Makrides SC. 1998. Strategies for optimizing inclusion bodies in recombinant Escherichia coli produ- heterologous protein expression in Escherichia coli. cing high levels of porcine somatotropin. J Biotechnol. Trends Biotechnol. 16:5460. 28:313320. Kim JW, Yoe SM. 2003. Isolation of lysozyme from the Singh SM, Panda AK. 2005. Solubilization and refolding hemolymph of sweet potato hornworm, Agrius convolvuli of bacterial inclusion body proteins. J Biosci Bioeng. Larvae. Korean J Ent. 33:161164. 99:303310. Kim JW, Yoe SM. 2008. Cloning and prokaryotic expression Stoscheck CM. 1990. Quantitation of protein. Methods of c-type lysozyme gene from Agrius convolvuli. Anim Enzymol. 182:5369. Cells Syst. 12:149155. Thatcher DR, Hitchcock A. 1994. Protein folding in bio- Kim JW, Park SI, Yoe JH, Yoe SM. 2011. Cloning and technology. In: Pain R.H., editor. Mechanism of protein overexpression of lysozyme from Spodoptera litura in folding. Oxford: Oxford University Press. p. 229261. prokaryotic system. Anim Cells Syst. 15:2936. Tsumoto K, Ejima D, Kumagai I, Arakawa T. 2003. Practical Kim JW, Yoe J, Lee GH, Yoe SM. 2011. Recombinant considerations in refolding proteins from inclusion expression and refolding of the c-type lysozyme from bodies. Protein Expr Purif. 28:18. Spodoptera litura in E. coli. Electron J Biotechnol Vallejo LF, Rinas U. 2004. Strategy for recovery of active [Internet]. [cited 2011 May 15]; 14. Available from: protein through refolding of bacterial inclusion body http://dx.doi.org/10.2225/vol14-issue3-fulltext-6. proteins. Microb Cell Fact. 3:212. Kim JW, Yoe SM. 2009. Isolation and characterization of Van Den Berg B, Ellis RJ, Dobson CM. 1999. Effects of the c-type lysozyme gene from the common cutworm macromolecular crowding on protein folding and aggre- Spodoptera litura. Anim Cells Syst. 3:345350. gation. EMBO J. 18:69276933.
Journal
Animal Cells and Systems
– Taylor & Francis
Published: Dec 1, 2012
Keywords: lysozyme; Agrius convolvuli; inclusion body; expression; refolding
