DeepDyve requires Javascript to function. Please enable Javascript on your browser to continue.
Photoperiod may regulate growth via leptin receptor A1 in the hypothalamus and saccus vasculosus of Atlantic salmon (Salmo salar) Photoperiod may regulate growth via leptin receptor A1 in the hypothalamus and saccus vasculosus...
Chi, Liang; Li, Xian; Liu, Qinghua; Liu, Ying
2019-05-04 00:00:00
ANIMAL CELLS AND SYSTEMS 2019, VOL. 23, NO. 3, 200–208 https://doi.org/10.1080/19768354.2019.1595138 Photoperiod may regulate growth via leptin receptor A1 in the hypothalamus and saccus vasculosus of Atlantic salmon (Salmo salar) a b b b Liang Chi , Xian Li , Qinghua Liu and Ying Liu a b Qingdao Agricultural University, Qingdao, People’s Republic of China; Institute of Oceanology Chinese Academy of Sciences, Qingdao, People’s Republic of China ABSTRACT ARTICLE HISTORY Received 12 December 2017 Photoperiod is believed to regulate growth in fish, although the mechanism involved is still unclear. Revised 14 February 2019 In this paper, we report a relationship between leptin-receptor A1 (AsLRa1), melatonin-receptor Accepted 17 February 2019 (AsMR) and photoperiod in Atlantic salmon. Atlantic salmon (mean weight 1071.70 ± 155.54 g) were reared under six photoperiod regimes, four constant light regimes 24L:0D, 18L:6D, 12L:12D KEYWORDS and 8L:16D, hours of light (L) and dark (D) and two varying light regimes, LL-SL = 24L:0D-8L:16D, Photoperiod; leptin receptor; and SL-LL = 8L:16D-24L:0D over a period of seven months. The results showed that AsLRa1 growth; Atlantic salmon transcripts were mainly existed in the hypothalamus and saccus vasculosus (SV), AsMR was mainly expressed in the hypothalamus. Long photoperiod inhibited the expression of AsLRa1 and AsMR transcripts in the Atlantic salmon brain. The expression pattern of AsLRa1 was similar to the expression pattern of AsMR in the hypothalamus. Food intake was higher in fish with lower AsLRa1 transcript levels. This demonstrated that photoperiod influenced somatic growth by changing expression of AsLRa1 in the hypothalamus and SV to affect appetite. In addition, we found that the SV appears to act as a seasonal sensor regulating reproduction in a similar way to the hypothalamus. Introduction synchronizing locomotor activity rhythms. Feeding activity mainly appears during the day, meanwhile, diet Environmental factors (e.g. day length, temperature, rhythms are affected strongly by LD cycles in Atlantic oxygen availability, rainfall, etc.) play important roles in salmon and rainbow trout (Oncorhynchus mykiss) (Iigo regulating physiological function, including reproduc- and Tabata 1997; Jones et al. 2002), suggesting that tion and growth in fish (Boeuf and Le Bail 1999; Shin day length could modify growth by increasing food et al. 2014). Among these environmental factors, only intake indirectly (Boeuf and Le Bail 1999). Atlantic salmon day length (photoperiod) shows periodicity with seaso- are sensitive to photoperiod, and some studies demon- nal changes, which is crucial to determine the timing strated that food intake and food conversion efficiency of reproduction and growth. Many researchers have are directly correlated and generally highest with increas- found that photoperiod could affect growth of fish. ing photoperiod (Berg et al. 1992). In conclusion, a long Such as Biswas et al reported that extended and continu- constant or increasing photoperiod promotes salmon ous photoperiods could significantly improve the growth growth. However, the mechanism of photoperiod influen- performance of striped knifejaw (Oplegnathus fasciatus) cing growth in fish is still not fully understood. (Biswas et al. 2016). Atlantic salmon (Salmo salar. L) Leptin is secreted by adipose tissue and has an impor- also displays seasonal changes in growth (Forsberg tant role in regulating appetite, adiposity, food intake 1995; Kadri et al. 1997), and as a consequence, their and energy expenditure in mammals (Fuentes et al. growth could be affected by day length or artificial 2013; Macdougald et al. 1995; Schwartz et al. 2000). light (Endal et al. 2000; Smith et al. 1993). Atlantic Leptin interacts with several neuropeptides to regulate salmon exhibit increased growth rate under continuous food intake in the hypothalamus (Minokoshi and Kahn light during winter compared with fish under to a 2003). The physiological functions of leptin are mediated natural photoperiod(Duncan et al. 1999; Kråkenes et al. by the leptin receptor (LR) in mammals (Bates et al. 2005). 1991; Oppedal et al. 2001; Porter et al. 1999). Further- In fish, leptin or LRs have been identified in many species more, light–dark (LD) transitions are also important in CONTACT Liang Chi lchi@qau.edu.cn Qingdao Agricultural University, Qingdao 266109, People’s Republic of China Supplemental data for this article can be accessed at https://doi.org/10.1080/19768354.2019.1595138 © 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. NEUROBIOLOGY & PHYSIOLOGY ANIMAL CELLS AND SYSTEMS 201 including zebrafish, medaka, Arctic charr, rainbow trout Six photoperiod treatment groups were designed. and Atlantic salmon (Froiland et al. 2010; Gorissen et al. Four of the photoperiods were constant throughout 2009; Kurokawa et al. 2005; Murashita et al. 2008; Ron- the experiment 24L:0D, 18L:6D, 12L:12D and 16L:8D nestad et al. 2010). The functions of leptin and LRs in [hours of light (L) and dark (D)]. The other two photo- fish are similar to those in mammals. The action of periods varied. In the first, the photoperiod changed leptin is mediated through LRs expressed on appetite- from 24L:0D to 8L:16D (LL-SL treatment), and in the related neurons and circuits in the hypothalamus (Liu second changed from 8L:16D to 24L:0D (SL-LL treat- et al. 2010). Studies in mammals have found that the ment), with the lighting period changing 5 min per day expression of leptin is rhythmic, which is related to the in both cases. Each group contained three replicate pineal melatonin axis in ruminants (Klocek-Gorka et al. tanks (60 fish/tank). The experiment was performed 2010; Zieba et al. 2007; Zieba et al. 2008). In fish, the from September to the following March, a period span- rhythm of leptin/LRs is mainly focused on the feeding ning the first reproductive period of Atlantic salmon. regime. Daily changes in leptin mRNA were first First, all fish in each tank were anesthetized using studied in Atlantic salmon, in which changes were seen 0.05% MS-222 and measured for body weight and in white muscle, belly flap, visceral adipose tissue and body length every month individually. Then fish were liver, when fish are exposed to short term feeding restric- sampled, and three fish in each tank were anesthetized tions (Moen and Finn 2013). Meanwhile, in goldfish, to death in seawater using 0.05% MS-222. Body mass hepatic leptin expression peaks appear at 9 h post and length were recorded. The gonads were stored in feeding (Tinoco et al. 2012). These results suggest that Bouin’s fixative for 24 h and then in 70% ethanol for his- leptin/LRs could be affected by environmental factors. tological examination to confirm the specific stage of the Up to now, however, our understanding of the relation- experimental fish. All of the procedures described in this ship of leptin/LRs and photoperiod is still limited. study were reviewed and approved by the ethical com- Photoperiod could regulate growth in fish and growth mittee of the Institute of Oceanology, Chinese is related to leptin and LRs, thus, we hypothesized that Academy of Sciences. there may be some relationship between photoperiod The feeding ratio (FR) was calculated as FR (%) = 100 × and leptin/LRs. Atlantic salmon, are native to the North F/[0.5 × (BW +BW )×(T -T )], where BW and BW were 2 1 2 1 1 2 Atlantic and its surrounding rivers, and were introduced the average individual weight at days T and T . F was 1 2 into China using Recirculating Aquaculture Systems total food consumption. (RAS). In our previous study, we found that photoperiod significantly affected growth of Atlantic salmon reared in RNA preparation, synthesis of first-strand cDNA a RAS. In this paper, the relationship between photo- and quantitative real-time PCR period and leptin/LRs of Atlantic salmon were investi- gated using a RAS. In addition, the regulation center The brain were isolate from encephalocoele using for photoperiod is mainly located in the brain, therefore, RNAase-free bone shears and tweezers, after that, the this study focused on Atlantic salmon LRs, which are also whole brain were washed 3 times in RNAase-free PBS. mainly expressed in the brain. Then the each part of brain [Telencephalon, Diencepha- lon, Hypothalamus (hypothalamus is located on the under surface of diencephalon and on the top of pitu- Materials and methods itary), Mesencephalon and saccus vasculosus (SV) (SV is a red saccus located on the back of medulla, and Experimental design it’sthe only redorganin fish brain)] were separated Atlantic salmon (weight: 1071.70 ± 155.54 g) were col- carefully using tweezers and scalpel and stored in lected from Shandong Oriental Ocean Sci-Tech Co. Ltd., Liquid nitrogen immediately. Total RNA were extracted Shandong province, China. The fish were randomly dis- from the different regions of the Atlantic salmon brain tributed into experimental RAS tanks (130 cm high × using a fast 200 RNA extraction kit (Fastagen, Shanghai, 200 cm diameter) and reared by satiation feeding with China), according to the manufacturer’s instructions. a commercial salmon diet (Skretting, Norway) containing Total RNA were dissolved in 20 μLRNase-freewater. 48% protein and 18% fat twice daily during the period of Then, 2 μg RNA was reverse transcribed to first-strand light manipulation, and the total food consumption of cDNA by a First- Strand cDNA Synthesis SuperMix each tank was recorded. Each experimental tank con- (TransGen, Beijing, China). The reaction system con- tained ∼60 fish. The water temperature was maintained tained 1μL genomic DNA remover, 0.5 μL Oligo dT at 16.27 ± 0.54°C, total ammonia-nitrogen < 0.25 mg/L, Primer, 10 μLof2×TS reaction mix and RNase-free salinity 24–26 and a pH between 7.2 and 7.5. water up to a volume of 20 μL. 202 L. CHI ET AL. Quantification of AsLRa1 and AsMR gene expression & TMR according to the manufacturer’s instruction was carried out with SYBR TransStart Top Green qPCR (NEL756, PerkinElmer). The nuclei were stained using SuperMix Kit (TransGen, Beijing, China) using the stan- 4’-6-diamidino-2-phenylindole (DAPI) and embedded in dard curve method with β-actin as a reference gene ProLong Gold Antifade reagent (Invitrogen, Carlsbad, and performed in an Eppendorf Mastercycler ep realplex CA, USA). The slides were then mounted and photo- real-time PCR instrument (Eppendorf, Germany). The graphed by Nikon Eclipse 50i fluorescence microscope primers used to amplify AsMR, AsLRa1 and β-actin are (Tokyo, Japan). In this procedure, two antisense RNA listed in Table 1. Amplification was performed in a 20 probes were co-incubated in a single sample during μL reaction volume according to the manufacturer’s the hybridization step, to develop red and green fluor- instructions, using 0.4 μL Passive Reference Dye, 10 μL escence (p-4) (Chi et al. 2017). 2×Top Green qPCR SuperMix, 1 μL cDNA, 0.4 μL(4 μM) forward and reverse primers and deionized distilled Histology water up to a final volume of 20 μL. The qPCR programs were performed as follow: 94°C for 30 s followed by 40 The Atlantic salmon brain were fixed in Bouin’s fixative cycles of 94°C for 5 s, 60°C for 15 s and 72°C for 10 s fol- for 24 h and preserved in 70% ethanol. The samples lowed by a temperature ramp for melting curve analysis. were stained using hematoxylin and eosin (H&E) and sec- tions were observed by a light microscope (NikonYS-100, Japan). Photographs were taken with a digital camera In situ hybridization of Atlantic salmon brains (Nikon coolpix-4500, Japan). The brains of Atlantic salmon were fixed in 4% parafor- maldehyde in 0.1 M PBS (phosphate buffered saline, pH 7.4) overnight at 4°C. The samples were dehydrated Statistical analysis in a graded series of methanol. Sections of paraffin- All statistical analyses were performed using SPSS embedded brains were prepared on 5μM glass slides version 20.0. The results were presented as means ± stan- coated with 0.1% poly-L-lysine solution. The partial CDS dard deviation (SD) and compared using a one-way of AsMR and AsLRa1a1 were cloned into pGEM-T analysis of variance (ANOVA) followed by Tukey’s test. vectors for preparing sense and antisense RNA probes All assays were performed independently in triplicate. from a T7 or SP6 promoter by using FITC or digoxigenin (DIG) RNA Labeling Kit (Roche) respectively (Table 2). The sections were hybridized with the sense or antisense Results probes at 66°C for 18 h. After hybridization, the Location of AsMR and AsLRa1a1 in the brain of samples were incubated overnight at 4°C with horse- Atlantic salmon radish peroxidase (HRP)-conjugated anti-FITC–antibody (Roche) at a 1:2000 dilution in blocking solution to The location of AsMR and AsLRa1 were examined by detect the FITC signal. After three washes in PBST, the quantitative real-time PCR with β-actin mRNA as a samples were incubated 1 h in tyraminde signal amplifi- loading control. The results showed that AsLRa1 was pri- cation (TSA)-fluorescein at a 1:150 dilution in TSA buffer. marily expressed in the diencephalon, pituitary gland The DIG signal was detected in samples. They were incu- and SV, and AsMR were mainly expressed in the dience- bated overnight at 4°C with HRP-conjugated anti-DIG phalon in the Atlantic salmon brain (Figure 1). To confirm antibody (Roche) at a 1:2000 dilution in blocking buffer the precise location of AsLRa1, the diencephalon and SV with 1% H O . Following three PBST washes, the 2 2 were isolated to perform in situ hybridization. The results samples were incubated in TSA-Plus tetramethylrhoda- showed that both AsLRa1 and AsMR transcripts were mine (TMR) for 1 h. Double color fluorescence in situ mainly expressed in the hypothalamus of the diencepha- hybridization was performed using TSA Plus fluorescein lon (Figure 2(G–I). In the SV, the AsLRa1 transcripts mainly appeared in the cerebrospinal fluid-contacting (CSF-c) Table 1. The primers used for Real-time RT-PCR. Genes Sequences of primers Products (bp) Table 2. Primers use for in situ hybridization. AsMR F: 5’-GCAACTTGCTGGTTATCATTTCAGTG-3’ 245 Genes Sequences R: 5- GTGACAGATGTAGCAGTAGCGGTTG-3 AsLR F:5’-GCTTATGATCCGCCTTTGAATTTGTG-3’ 284 AsMR F: 5’ CATCAACCGCTACTGCTACATCTGTCA 3’ R:5’-CTCGGTCTTCTTCCTTTCCTCTGTTG-3’ R: 5’ CACCTCTGTCTTCACCTTCCTCCTCA3’ β-actin F: 5’-ATCCACGAGACCACCTACAACTCC-3’ 268 AsLR F:5’ GGGCACTGTTACTGAGGAGCGAATA 3’ R: 5’-CGTACTCCTGCTTGCTGATCCAC-3’ R:5’ CGACCACTCTACAACCAGGGACCAC 3 Note: F: forward primer; R: reverse primer. Note: F: forward primer; R: reverse primer. ANIMAL CELLS AND SYSTEMS 203 At the end of the experiment, the lowest level of AsMR transcripts appeared in the 24L:0D and SL-LL groups and the highest level in the 8L:16D and LL-SL groups (Figure 3(B)). Furthermore, the expression of AsMR in the hypothalamus were detected using in situ hybridiz- ation, the results show that the expression levels of AsMR under long photoperiod (24L:0D)transcripts were significantly higher than short photoperiod (8L:16D) (Figure 3(C)). Figure 1. Distribution of AsLRa1 and AsMR in the Atlantic salmon brain. Tel: telencephalon; Dien: diencephalon; Mes: mesencepha- Expression pattern of AsLRa1 in different lon; Pit: pituitary gland; Vas: saccus vasculosus. photoperiods in the hypothalamus and SV of Atlantic salmon cells (Figure 2(D–F). The histology of SV were shown in Since AsLRa1 was mainly expressed in the hypothalamus supply materials.) and SV, we examined the expression pattern of AsLRa1 in the hypothalamus and SV under different photoperiod. The results showed that photoperiod affected the Expression pattern of AsMR in the different expression of AsLRa1 in the hypothalamus and SV. In photoperiod in the hypothalamus of Atlantic the hypothalamus, AsLRa1 transcripts were lowest in salmon the 24L:0D and the LL-SL photoperiod groups (Figure 4 Expression of AsMR in the hypothalamus could be (A)) at the early stage of the experiment. At this time, influenced by photoperiod. At the beginning of the these two treatments had the longest photoperiod. At experiment, the AsMR transcripts levels were lowest in the end time of the experiment, the lowest AsLRa1 tran- the 24L:0D group, followed by the LL-SL group. The scripts levels were in the 24L:0D group followed by the expression level of AsMR transcripts was highest in the SL-LL group (Figure 4(B)). The expression of AsLRa1 in 8L:16D group followed by the SL-LL group (Figure 3(A)) the hypothalamus were also detected using in situ Figure 2. Expression of AsLRa1 and AsMR in the hypothalamus and saccus vasculosus. (A–C) Expression pattern of AsLRa1 in the hypo- thalamus of Atlantic salmon brain; (D, E) Expression pattern of AsLRa1 in th saccus vasculosus of Atlantic salmon brain; (G–I) Location of AsMR mRNA in the hypothalamus using in situ hybridization. The green arrow indicates the cerebrospinal fluid-contacting cells; and the red arrow indicates the coronet cells. SV: saccus vasculosus; Hyp: hypothalamus. 204 L. CHI ET AL. Figure 3. Expression pattern of AsMR transcripts in different photoperiods. (A): Expression pattern of AsMR transcripts in different photoperiod at the early stage of the experiment; (B): Expression pattern of AsMR transcripts in different photoperiod at the end of the experiment. Different letters indicate statistical significance at p < 0.05; (C): The expression of AsMR in the Atlantic salmon hypo- thalamus in long photoperiod (a) and short photoperiod (b) are assayed using in situ hybridization hybridization, the results show that the expression levels in the SV is similar to the hypothalamus. However, the of AsLRa1 under long photoperiod (24L:0D)transcripts expression level of AsLRa1 in the SV is lower than that were significantly higher than short photoperiod in the hypothalamus (Figure 5(A,B)). And the expression (8L:16D) (Figure 4(C)). The expression pattern of AsLRa1 levels of AsLRa1 in SV under long photoperiod (24L:0D) Figure 4. Expression pattern of AsLRa1 transcripts in the Atlantic salmon hypothalamus in different photoperiods. (A): Expression pattern of AsLRa1 transcripts in different photoperiods at the early stage of the experiment; (B): Expression pattern of AsLRa1 transcripts in different photoperiods at the end of the experiment. Different letters indicate statistical significance at p < 0.05. (C): The expression of AsLRa1 in the Atlantic salmon hypothalamus in long photoperiod (a) and short photoperiod (b) are assayed using in situ hybridization ANIMAL CELLS AND SYSTEMS 205 Figure 5. Expression pattern of AsLRa1 transcripts in the Atlantic salmon SV in different photoperiod. (A): Expression pattern of AsLRa1 transcripts in different photoperiods at the early stage of the experiment; (B): Expression pattern of AsLRa1 transcripts in different photoperiods at the end of the experiment. Different letters indicate statistical significance at p < 0.05. (C): The expression of AsLRa1 in the Atlantic salmon SV in long photoperiod (a) and short photoperiod (b) are assayed using in situ hybridization transcripts were higher than short photoperiod (8L:16D) LepRA2, and they suggested that leptin’s roles as modu- (Figure 5(C)). lator of nutritional status in Atlantic salmon might be governed by distinct genetic evolutionary processes and distinct functions between the paralogs, however, Food intake of Atlantic salmon in different what’s the role of two paralogs are still not clear photoperiods (Angotzi et al. 2016; Yan et al. 2017). The daily FR could be affected by photoperiod. At the In this experiment, the fish were reared in a RAS, which provide a nearly consistent environment for Atlan- early stage of the experiment, the higher FR appeared tic salmon. Furthermore, RAS enables the study of the in the 24L:0D photoperiod (1.21%/day), followed by the LL-SL photoperiod group(1.19%/day) (Figure 6(A)). At effects of the photoperiod on growth, independent of the end of the experiment, the highest FR were found other environmental factors. In our previous study, we found that photoperiod also promoted somatic growth in the 24L:0D photoperiod group (1.18%/day) and SL- LL photoperiod group (1.17%/day), (the photoperiod of Atlantic salmon reared in RAS (in press). In order to was longest at the end of experiment) (Figure 6(B)). investigate the mechanism behind the effect of photo- period on the growth of Atlantic salmon, we examined the relationship between photoperiod and AsLRa1. Discussion Firstly, we determined the location of AsLRa1 in the Atlantic salmon brain. The results showed that AsLRa1 Leptin exerts its appetite-inhibiting effects by acting on transcripts were mainly expressed in the hypothalamus the appetite control within the hypothalamus, and its and SV. This indicated that leptin may play a role in can regulates a crowd of neuropeptides which located both the hypothalamus and SV of Atlantic salmon. The in hypothalamic (Crown et al. 2007). Furthermore, some SV is a circumventricular organ of the hypothalamus researchers have found that leptin may regulate the and unique to fish, the function of SV is still unclear. A expression and secretion of pituitary hormones in pitu- recent study found that the SV of masu salmon is a itary directly, by activating leptin receptor (Lloyd et al. sensor of seasonal changes in day length (Nakane et al. 2001; Sone et al. 2001). However, whether leptin/leptin 2013). In order to investigate whether the SV is an receptor were controlled by photoperiod is still unclear. organ that can regulate seasonal growth via the LR in In recent years, Angotzi et al found a novel leptin Atlantic salmon, the changes in expression of AsLRa1 receptor duplicate in Atlantic salmon, named LepRA1and 206 L. CHI ET AL. Figure 6. Feeding ratio (FR) of Atlantic salmon in different photoperiods. (A): FR of Atlantic salmon under different photoperiods at the early stage of the experiment; (B): The FR of Atlantic salmon under different photoperiods at the end of the experiment. Different letters indicate statistical significance at p < 0.05. under different photoperiod treatments were examined. Secondly, the expression pattern of AsLRa1 in the The changes in AsLRa1 transcript levels in the SV under hypothalamus and SV of Atlantic salmon in different photoperiods was examined by qPCR. Expression of the different photoperiod treatments are similar to the changes in the hypothalamus. However, the expression AsLRa1 was affected by photoperiod, and long photo- levels of AsLRa1 are lower than those in the hypothala- period suppressed the expression of AsLRa1 both in the hypothalamus and SV. Melatonin is the most impor- mus. In our previous paper, we found that SV is an organ which can regulate reproduction via photoperi- tant internal timekeeping molecule that is involved in odic signals (Chi et al. 2017). Here, we found that the the control of daily variations of locomotor activity, such as growth and reproduction in fish (Boeuf and LR in Atlantic salmon SV share the same pattern with kis- speptin receptor. So we suggest that in the Atlantic Falcon 2001; Falcon et al. 2003; Zachmann et al. 1992). salmon, the SV also assists in regulating growth via In order to confirm whether AsLRa1 could be affected by photoperiod, we also examined the expression of photoperiodic signals besides the hypothalamus. ANIMAL CELLS AND SYSTEMS 207 Biswas A, Takaoka O, Kumai H, Takii K. 2016. Combined effect of MR of Atlantic salmon in the hypothalamus under photoperiod and self-feeder on the growth performance of different photoperiods. The results showed that the striped knifejaw. Oplegnathus fasciatus. Aquaculture. 1 expression of AsMR in the hypothalamus had a similar (452):183–187. expression pattern in the different photoperiods as Boeuf G, Falcon J. 2001. Photoperiod and growth in fish. VIE AsLRa1. Furthermore, we found that both AsMR and MILIEU. 51:247–266. AsLRa1 were expressed in the same cells in hypothala- Boeuf G, Le Bail PY. 1999. Does light have an influence on fish growth? Aquaculture. 177:129–152. mus. So we speculated that the rhythm of AsLRa1 Chi L, Li X, Liu Q, Liu Y. 2017. Photoperiod regulate gonad devel- might be regulated by photoperiod via melatonin. opment via kisspeptin/kissr in hypothalamus and saccus vas- After confirming the relationship between photo- culosus of Atlantic salmon (Salmo salar). PloS One. 12: period and AsLRa1, we investigated whether food e0169569. intake was affected by photoperiod. The results Crown A, Clifton DK, Steiner RA. 2007. Neuropeptide signaling in the integration of metabolism and reproduction. showed that the daily FR was affected by photoperiod. Neuroendocrinology. 86:175–182. FR of Atlantic salmon was higher during a long photo- de Git KCG, Adan RAH. 2015. Leptin resistance in diet-induced period compared to short photoperiod. Meanwhile, obesity: the role of hypothalamic inflammation. Obes. Rev. the expression pattern of AsLRa1 is contrasted with 16:207–224. the pattern of food intake. So we speculated that Duncan N, Mitchell D, Bromage N. 1999. Post-smolt growth and in the long photoperiod, the expression AsLRa1 was maturation of out-of-season 0+ Atlantic salmon (Salmo salar) reared under different photoperiods. Aquaculture. 177:61–71. inhibited, which increased the appetite of Atlantic Endal HP, Taranger GL, Stefansson SO, Hansen T. 2000.Effects of salmon, and led to higher growth rate. In the short continuous additional light on growth and sexual maturity in photoperiod, the AsLRa1 transcript levels were higher, Atlantic salmon. Salmo salar, reared in sea cages. and the AsLRa1 would induce higher expression of Aquaculture. 191:337–349. leptin to suppress appetite (de Git and Adan 2015). Falcon J, Besseau L, Fazzari D, Attia J, Gaildrat P, Beauchaud M, Boeuf G. 2003. Melatonin modulates secretion of growth Then Atlantic salmon would have higher growth rate hormone and prolactin by trout pituitary glands and cells under the long photoperiod and show lower growth in culture. Endocrinology. 1(144):4648–4658. rates under the short photoperiod. In conclusion, we Forsberg OI. 1995. Empirical investigations on growth of post- found that photoperiod regulated growth of Atlantic smolt Atlantic salmon (salmo-salar L) in land-based farms- salmon may occur via the LRs receptor both in the hypo- evidence of a photoperiod influence. Aquaculture. thalamus and saccus vasculosus. 133:235–248. Froiland E, Murashita K, Jorgensen EH, Kurokawa T. 2010. Leptin and ghrelin in anadromous Arctic charr: Cloning and change in expressions during a seasonal feeding cycle. Gen. Comp. Disclosure statement Endocrinol. 165:136–143. No potential conflict of interest was reported by the authors. Fuentes EN, Safian D, Einarsdottir IE, Valdes JA, Elorza AA, Liang Chi and Xian Li are equal contribution for this paper. Molina A, Bjornsson BT. 2013. Nutritional status modulates plasma leptin. AMPK and TOR activation, and mitochondrial biogenesis: Implications for cell metabolism and growth in skeletal muscle of the fine flounder. Gen. Comp. Funding Endocrinol. 186:172–180. This work was supported by National Natural Science Fund of Gorissen M, Bernier NJ, Nabuurs SB, Flik G, Huising MO. 2009. China: [Grant Number 31402283]; National Key R&D Program Two divergent leptin paralogues in zebrafish (Danio rerio) of China: [Grant Number No. 2017YFB0404000]. that originate early in teleostean evolution. J. Endocrinol. 201:329–339. Iigo M, Tabata M. 1997. Circadian rhythms of locomotor activity in the rainbow trout Oncorhynchus mykiss. Fish. Sci. 63:77–80. References Jones W, Gurney WSC, Speirs DC, Bacon PJ, Youngson AF. 2002. Angotzi AR, Stefansson SO, Nilsen TO, Øvrebø JI, Andersson E, Seasonal patterns of growth, expenditure and assimilation in Taranger GL, Rønnestad I. 2016. Identification of a novel juvenile Atlantic salmon. J. Anim. Ecol. 71:916–924. leptin receptor duplicate in Atlantic salmon: expression ana- Kadri S, Metcalfe NB, Huntingford FA, Thorpe JE. 1997. Daily lyses in different life stages and in response to feeding status. feeding rhythms in Atlantic salmon. 2. Size-related variation Gen. Comp. Endocrinol. 235:108–119. in feeding patterns of post-smolts under constant environ- Bates SH, Kulkarni RN, Seifert M, Myers MG. 2005. Roles for mental conditions. J. Fish. Biol. 50:273–279. leptin receptor/STAT3-dependent and -independent signals Klocek-Gorka B, Szczesna M, Molik E, Zieba DA. 2010. The inter- in the regulation of glucose homeostasis. Cell Metab. actions of season, leptin and melatonin levels with thyroid 1:169–178. hormone secretion, using an in vitro approach. Small Berg A, Hansen T, Stefansson S. 1992. First feeding of Atlantic Ruminant Res. 91:231–235. salmon (Salmo salar L. under different photoperiods. J. Kråkenes R, Hansen T, Stefansson SO, Taranger GL. 1991. Appl. Lchthyol. 8:251–256. Continuous light increases growth rate of Atlantic salmon 208 L. CHI ET AL. (Salmo salar L.) postsmolts in sea cages. Aquaculture. 95:281– Leptin and leptin receptor genes in Atlantic salmon: 287. Cloning, phylogeny, tissue distribution and expression corre- Kurokawa T, Uji S, Suzuki T. 2005. Identification of cDNA coding lated to long-term feeding status. Gen. Comp. Endocrinol. for a homologue to mammalian leptin from pufferfish. 168:55–70. Takifugu rubripes. Peptides. 26:745–750. Schwartz MW, Woods SC, Porte D, Seeley RJ, Baskin DG. 2000. Liu Q, Chen Y, Copeland D, Ball H, Duff RJ, Rockich B, Londraville Central nervous system control of food intake. Nature. RL. 2010. Expression of leptin receptor gene in developing 404:661–671. and adult zebrafish. Gen. Comp. Endocrinol. 166:346–355. Shin HS, Habibi HR, Choi CY. 2014. The environmental regu- Lloyd RV, Jin L, Tsumanuma I, Vidal S, Kovacs K, Horvath E, lation of maturation in goldfish. Carassius auratus: effects Scheithauer BW, Couce ME, Burguera B. 2001. Leptin and of various LED light spectra. Comp. Biochem. Physiol. A- leptin receptor in anterior pituitary function. Pituitary. 4:33–47. Mol. Integr. Physiol. 168:17–24. Macdougald OA, Hwang CS, Fan HY, Lane MD. 1995. Regulated Smith IP, Metcalfe NB, Huntingford FA, Kadri S. 1993. Daily and expression of the obese gene-product(leptin) in white seasonal patterns in the feeding behavior of Atlantic adipose-tissue and 3t3-l1 adipocytes. Proc. Natl. Acad. salmon (Salmo-salars L) in sea cage. Aquaculture. Sci. U. S. A. 92:9034–9037. 117:165–178. Minokoshi Y, Kahn BB. 2003. Role of AMP-activated protein Sone M, Nagata H, Takekoshi S, Osamura YR. 2001. Expression kinase in leptin-induced fatty acid oxidation in muscle. and localization of leptin receptor in the normal rat pituitary Biochem. Soc. Trans. 31:196–201. gland. Cell Tissue Res. 305:351–356. Moen AGG, Finn RN. 2013. Short-term, but not long-term feed Tinoco AB, Nisembaum LG, Isorna E, Delgado MJ, de Pedro N. restriction causes differential expression of leptins in 2012. Leptins and leptin receptor expression in the Atlantic salmon. Gen. Comp. Endocrinol. 183:83–88. goldfish (Carassius auratus). regulation by food intake and Murashita K, Uji S, Yamamoto T, Ronnestad I, Kurokawa T. 2008. fasting/overfeeding conditions. Peptides. 34:329–335. Production of recombinant leptin and its effects on food Yan A, Chen Y, Chen S, Li S, Zhang Y, Jia J, Yu H, Liu L, Liu F, Hu C. intake in rainbow trout (Oncorhynchus mykiss). Comp. 2017. Leptin Stimulates Prolactin mRNA expression in the Biochem. Physiol. B-Biochem. Mol. Biol. 150:377–384. goldfish pituitary through a Combination of the PI3K/Akt/ Nakane Y, Ikegami K, Iigo M, Ono H, Takeda K, Takahashi D, mTOR, MKK3/6/p38MAPK and MEK1/2/ERK1/2 Signalling Uesaka M, Kimijima M, Hashimoto R, Arai N, et al. 2013. Pathways. Int. J. Mol. Sci. 18:2781. The saccus vasculosus of fish is a sensor of seasonal Zachmann A, Ali MA, Falcon J. 1992. Melatonin and its effects in changes in day length. Nat. Commun. 4:1–7. fishes-an overview. Oppedal F, Juell JE, Tarranger G, Hansen T. 2001. Artificial light Zieba DA, Klocek B, Williams GL, Romanowicz K, Boliglowa L, and season affects vertical distribution and swimming Wozniak M. 2007. Vitro evidence that leptin suppresses mel- behaviour of post-smolt Atlantic salmon in sea cages. J. atonin secretion during long days and stimulates its Fish. Biol. 58:1570–1584. secretion during short days in seasonal breeding ewes. Porter MJR, Duncan NJ, Mitchell D, Bromagea NR. 1999. The use Domest. Anim. Endocrinol. 33:358–365. of cage lighting to reduce plasma melatonin in Atlantic Zieba DA, Szczesna M, Klocek-Gorka R, Molik E, Misztal T, salmon (Salmo salar) and its effects on the inhibition of gril- Williams GL, Romanowicz K, Stepien E, Keisler DH, sing. Aquaculture. 176:237–244. Murawski M. 2008. Seasonal effects of central leptin infusion Ronnestad I, Nilsen TO, Murashita K, Angotzi AR, Moen AGG, on secretion of melatonin and prolactin and on SOCS-3 gene Stefansson SO, Kling P, Bjornsson BT, Kurokawa T. 2010. expression in ewes. J.Endocrinol. 198:147–155.
http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png
Animal Cells and Systems
Taylor & Francis
http://www.deepdyve.com/lp/taylor-francis/photoperiod-may-regulate-growth-via-leptin-receptor-a1-in-the-lxXJeJTTUM
