Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/wolters-kluwer-health/identification-of-key-genes-and-active-anti-inflammatory-ingredients-0RhfIEjbYG
- Publisher
- Wolters Kluwer Health
- Copyright
- Copyright © 2022 Tianjin University of Traditional Chinese Medicine.
- ISSN
- 2765-8619
- DOI
- 10.1097/hm9.0000000000000049
- Publisher site
- See Article on Publisher Site
Abstract
Objective: We aimed to establish a novel strategy for identifying key genes and active anti-inflammatory ingredients in Panax medicinal plants. Methods: First, fresh roots of 2-year-old Panax plants, including P. ginseng C. A. Mey., P. quinquefolium L., P. notoginseng (Burk.) F. H. Chen, P. japonicus C.A.Mey., P. japonicus Mey. var. major (Burk.) C. Y. Wu et K. M. Feng, were selected as explants, and callus formation was induced under three experimental temperatures (17, 24, and 30°C). Second, high-performance liquid chromatography-mass spectrometry was used to analyze the saponin content of the callus. Nitric oxide reduction efficacy was used for “component-efficacy” gray correlation analysis to find the active anti-inflammatory ingredients. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) was used to determine the inflammatory factors and verify the active ingredients’ anti-inflammatory effects. Finally, qRT-PCR was used to detect the expression of key genes in the callus, and “gene-component” gray correlation analysis was used to examine the relationships between the regulatory pathway of the genes and the components. Results: Among the three experimental temperatures (17, 24, and 30°C), the lowest temperature (17°C) is the most suitable for generating Panax callus. Lower-latitude native Panax notoginseng is more adaptable under high culture temperatures (24°C and 30°C) than other Panax plants. The ginsenoside contents of the callus of P. notoginseng and P. japonicus were the highest under similar climate conditions (17°C). Major anti-inflammatory components were G-Rh1, G-Rb1, G-Rg3, and G-Rh6/Floral- GKa. CYP76A47 contributed to the accumulation of anti-inflammatory components. Conclusions: This study provides a strategy for the gene-component-efficacy correlational study of multi-component, multi- functional, and multi-purpose plants of the same genus. Keywords: Anti-inflammatory ingredient, Gene-component-efficacy gray correlation analysis, HPLC–MS, Panax, qRT-PCR; Callus culture Graphical abstract: http://links.lww.com/AHM/A38 [1] medicines worldwide . The word “Panax” originated Introduction from the Latin words “pan” (all) and “zxos” (medicine Many Panax medicinal plants with potent therapeu- treatment), indicating the practicality of these plants for tic or auxiliary effects are used in traditional herbal [2] the treatment of many diseases . Their medicinal value is recognized for treating cardiovascular, cerebrovascu- Jiao Ai and Yongshen Ren contributed equally to this work. [3–4] lar, and nervous-system diseases . The pharmacolog- School of Pharmaceutical Science, South-Central University for ical activities include anti-inflammatory, anti-allergic, Nationalities, Wuhan, Hubei, China; School of Pharmacy, Hubei [5–6] anti-aging, and anti-tumor functions . Panax ginseng, University of Chinese Medicine, Wuhan, Hubei, China P. notoginseng, P. quinquefolium, P. japonicas, and * Corresponding author. Yongshen Ren, School of Pharmaceutical Panacis majoris are the most common species with sig- Sciences, South-Central University for Nationalities, Wuhan 430074, [2] nificant therapeutic efficacy . For example, according to China, E-mail: godreny@mail.scuec.edu.cn. traditional Chinese medicine (TCM) theory, P. ginseng Copyright © 2022 Tianjin University of Traditional Chinese Medicine. can provide vital energy and P. notoginseng can prevent This is an open-access article distributed under the terms of the congestion and stop bleeding, P. japonicus can nourish Creative Commons Attribution-Non Commercial-No Derivatives the body, and Panacis majoris rhizomes can maintain the License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be lungs, while P. quinquefolium can provide nourishment [7] changed in any way or used commercially without permission from the “qi” and “yin” . journal. Panax plants have congeneric active ingredients such as Acupuncture and Herbal Medicine (2022) 2:4 ginsenosides. Ginsenosides can be divided into two groups Received 18 January 2022 / Accepted 13 October 2022 according to the structure of the glycosides: dammarane and oleanane. The dammarane type can be further divided http://dx.doi.org/10.1097/HM9.0000000000000049 261 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com [8] into panaxadiol (PPD) and panaxatriol (PPT) . The gin- The study aimed to identify the key biosynthetic path- senoside types and contents differ in different Panax ways underlying the main efficacious substances and to plants, significantly impacting each plant's properties, provide a scientific strategy for new drug development efficacy, and clinical application. The variation in ginseno- based on bioartificial synthesis. side types and contents of the Panax plant greatly affects their properties, effectiveness, and clinical application. Material and methods This should be studied further to show the component-ef- Herb collection ficacy relationship and their biosynthetic pathways. Such research could improve medication accuracy and provide The fresh roots of five species of biennial Panax plants a scientific basis for new drug development. were collected for callus culture. Ginseng (RS), P. ginseng The environment plays an important role in plant Meyer., was collected from Fusong county, Jilin Province, secondary metabolism, especially in medicinal plants. China, and represents a high latitude species. American Secondary metabolites exhibit remarkable changes with ginseng (XYS), P. quinquefolium L., was collected from changes in the growth environment. Environmental Fusong county, Jilin province, China; it represents a changes lead to differences in dominant gene expression high latitude species. Notoginseng (SQ), P. notoginseng in plants; even plants of the same family and genus that (Burk.) F. H. Chen, was collected from Wenshan county, are grown in different environments will exhibit signifi- Yunnan province, China; it represents a low-latitude cant changes in dominant gene expression, which mani- species. Panax japonicas (ZJS), P. japonicus C.A.Mey., fests as differences in the characteristics of the plant and was collected from Enshi county, Hubei province, China; its secondary metabolites. Thus, controlling and chang- it represents a middle latitude species. Panacis majoris ing the plant growth environment artificially, especially rhizome (ZZS), P. japonicus Mey. var. major (Burk.) C. with congeneric plants distributed in different regions, Y. Wu et K. M. Feng, was collected from Enshi county, can allow an understanding of the relationship between Hubei province, China, representing a mid-latitude vari- [9–13] gene regulation and secondary metabolite synthesis . ety. All samples were identified by Professor Maochuan Recently, in vitro plant culture, including callus cul- Liao of the South-Central University for Nationalities ture, somatic embryo culture, cell suspension culture, and stored in room 13304, National Medicine Research hairy root culture, and adventitious root culture, has Laboratory, South-Central University for Nationalities, become increasingly regarded as an alternative to tradi- Wuhan, China. tional plant cultivation. It is used for obtaining bioactive metabolites and makes it possible to investigate the gene Media preparation and callus culture regulation mechanism of secondary metabolite synthesis. Existing studies have demonstrated that, compared Preparation and sterilization of Murashige–Skoog (MS) medium. Exactly 4.74 g MS medium, 2.0 mg 2,4-D with full light, a shaded environment is more conducive to the expression of Damenediol synthetase (DS), β-Amyrin (2,4-dichlorophenoxyacetic acid), 0.1 mg KT (6-furfu- [14–15] [24] rylaminopurine) , and 30 g sucrose and 7 g agar were (β-As) in ginseng and other key enzyme genes in the process of ginsenoside synthesis, while a low temperature placed in a 1 L beaker, and 1 L water was added to the beaker. After slightly boiled, the pH was adjusted to is more conducive to the response of Squalene synthase1, DS-II, Squalene epoxidase1, and HMG-CoA reductase2 5.8. The mixture was separated into the culture bot- [16] tles and sterilized for 20 minutes (121°C, 0.105 MPa). than room temperature . Gene expression changes in Panax plants will also change the corresponding effec- The sterilized containers were then cooled to room temperature. tive components. For example, co-overexpression of the HMGR gene and SS gene can enhance the synthesis of Disinfection and inoculation of explant: First, fresh [17–18] roots of Panax plants were rinsed with running water triterpene saponins and phytosterols . [19–20] Liquid chromatography-mass spectrometry is an for 30 min and transferred to a sterile operation plat- form (SW-CJ-1FD, Purification Equipment Co., Ltd., effective method for analyzing and identifying bioactive substances quantitative reverse-transcription polymerase Tongjing, Jiangsu). After soaking in 70% alcohol for [21] 60 s, the roots were rinsed with sterile water four times, chain reaction (qRT-PCR) is the conventional method used to identify and characterize key genes and is widely placed into 2% NaOCl for 5 min, and repeatedly rinsed with sterile water four times. Second, the roots were used in quantitative gene expression detection. Gray cor- [22] relation analysis (GCA) is a powerful method for study- placed in 0.2% mercuric chloride for 5 min, rinsed with sterile water 4 times, and the surface water was absorbed ing the effective material basis of Chinese herbal medicines (CHMs). It can be used to analyze the complex relation- with sterile filter paper. Finally, the roots were cut into 5 mm × 5 mm × 3 mm pieces and placed into culture bot- ships in multi-component and multi-efficacy plants by cal- culating and identifying the main active ingredients. tles under sterile conditions. Each bottle was inoculated with three explants. In this research, the above-mentioned methods were applied to analyze the components of Panax synthesized Callus culture: The tissue culture bottles were put into [23] three incubators (HM-430; Electronic Technology Co., in callus culture. A phylogenetic tree was constructed to analyze the homology of Panax plants and assess Ltd. Hengmei, Shandong) dark culture with tempera- ture settings at 17, 24, and 30°C, respectively, to simu- intra- and inter-generic genetic relationships. The com- bined application of related technologies in this study late different growth temperature conditions. The 17°C samples were named 17ZJS, 17ZZS, 17XYS, 17RS, and was expected to provide a new strategy for analyzing gene regulation of secondary metabolite synthesis in 17SQ, and the P. notoginseng sample placed at 24°C was named 24SQ, while the one at 30°C was named 30SQ. congeneric plants under different artificial environments. 262 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com Ginsenoside extraction tetrazolium assay in the early stage of the experiment and showed no cell toxicity. Subsequently, according to the First, fresh radicals and callus of Panax samples were Griess Kit (L-2B80, Biotechnology Co., Ltd. Jiancheng, dried in an oven (50°C) and then crushed and sifted Nanjing, China) manufacturer’s instructions, NO excre- through a 65 µm mesh sieve, respectively. The powder tion was detected 24 h after LPS stimulation and drug was weighed, and about 1.0 g was placed separately into (Ginsenosides extracts) administration. The control group 50 mL centrifuge tubes. Exactly 5 mL of 75% ethanol [25–26] (KB) was provided with the same volume of PBS . was added and extracted by ultrasonic wave three times for 30 min (65°C, 100 Hz). Second, the supernatant of the ethanol extractions was combined, and rotary evap- “Component-efficacy” relational analysis orated to dryness (65°C, −0.1 MPa, 60 rpm). The precip- The data processing system (DPS) V15.10 advanced itate was dissolved in 10 mL distilled water, washed with edition (Information Technology Co., Ltd. Ruifeng, 5 mL petroleum ether three times, and then extracted Hangzhou) was used for gray correlation analysis (GCA) with 5 mL n-butanol three times. The n-butanol lay- to (1) explore the relationship between the anti-inflam- ers were combined and evaporated to dryness at 80°C. matory effect and secondary metabolite synthesis, and Finally, the precipitates were stored at 4°C. (2) ascertain the most important components that play a regulatory role against inflammation. HPLC–MS analysis The Ginsenosides extracts were dissolved in methanol, qRT-PCR detection of key genes in samples diluted to 10 mL to a final concentration of 0.1 g/mL First, total RNA was extracted according to the instruc- of crude herb or callus, and filtered through a 0.22 µm tions of the spin-column plant total RNA extraction membrane for further analysis. The HPLC–MS finger - and Purification Kit (B518661; Bioengineering Co., Ltd., prints were recorded on an Agilent 1200 HPLC instru- Shanghai, China). The concentration and purity of RNA ment coupled with Agilent 6420 Triple Quad Mass were determined with a nanodrop instrument. The cDNA spectrometer via ESI interface (Thermo Fisher, San Jose, was synthesized according to the instructions of the cDNA CA). The samples were separated on high-performance synthesis Kit (B532445-0020). Finally, SGExcel FastSYBR liquid chromatography (Agilent 1200 HPLC system) Mixture (B532955-0005, Bioengineering Co. Ltd.) was equipped with a Welch X UPLC C column (100 used as the premixed system for real-time fluorescence mm × 2.1 mm, 1.8 μm). A two-component mobile phase quantitative detection. The PCR reactions were placed was used; one composed of 0.1% formic acid aqueous in the quantitative fluorescence analyzer (Prism@ 7500; solution (A) and the other acetonitrile (B). The follow- TaKaRa Bio, Shiga, Japan) for detection. The PCR reaction ing gradient elution program was applied: 0 to 8 min, procedure was as follows: pre-denaturation at 95°C for 30 80% to 79% A; 8 to 9 min, 79% to 74% A; 9 to 30 min, 40 cycles aof denaturation at 95°C for 5 s, and anneal- min, 74% to 68% A; 30 to 44 min, 25% to 1% A. The ing at 60°C for 20 s. The primers designed by Primer 5.0 injection volume was 10 µL, the flow rate was 0.4 mL/ software are shown in Tables 1 and 2. min, and the column temperature was set at 27°C. MS conditions: the ionization temperature was maintained at 350°C, the scanning range was 100 to 2,000 Da, the “Gene-component” relational analysis capillary voltage was 3,000 to 3,500 V, and the spray The DPS tool was used for GCA to explore the relation- pressure was 250 kPa. ship between gene regulation and secondary metabolite synthesis. GCA is very effective for finding key genes that Determination of anti-inflammatory efficacy can upregulate anti-inflammatory component expression. RAW264.7 macrophages were used to study the anti-in- flammatory efficacy of Panax medicinal plants and their Construction of the phylogenetic tree callus. Macrophages were stimulated to M1 macro- phages by 1 μg/mL lipopolysaccharide (LPS) in vitro. The The ginseng genome database was used to identify the ginsenosides extracts mentioned above were diluted in UGT family mRNA sequences. BLAST was used for DMEM to 0.5 to 5 mg/mL (crude herb concentration). mRNA sequence comparison. GO was used for homol- The concentration was assessed with the methyl thiazolyl ogous sequence comparison. The targets and amino acid Table 1 Gene primers in macrophages Gene Gene Bank ID Forward primer (5’-3’) Reverse primer (5’-3’) GADPH AY618569.1 CCCATGATGTCGGACCCTAA TGTCATGAATGAACTCGGAGGTG NM_008361.4 AGTTGACGGACCCCAAAAGATGAAG TTCTCCACAGCCACAATGAGTGATAC IL-1β IL-6 M24221.1 CTTCTTGGGACTGATGCTGGTGAC AGTGGTATCCTCTGTGAAGTCTCCTC CXCL10 U58677.1 CCGTAGTGTAGTTGCTCCTGTATGTATC GATGGAGGTGCCCTAGTCCTGAAG TNF-a NM_011609.4 AATTACCTCAGGCAGTGTCTCAGTTG GTCTCACTCAGGTAGCGTTGGAAC MCP-1 NM_001303244.1 CGTTTATGTTGTAGAGGTGGACTGGAC ATGTCATCTTCTTCAGGCGTGTCAC MMP-9 NM_013599.5 AAACCCTGTGTGTTCCCGTTCATC AGTTTATCCTGGTCATAGTTGGCTGTG TGF-β1 NM_011577.2 GCAACAATTCCTGGCGTTACCTTG GAAAGCCCTGTATTCCGTCTCCTTG 263 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com Table 2 Gene primers in Panax Gene Gene Bank ID Forward primer (5’-3’) Reverse primer (5’-3’) SS AB010148 TTGGAAGCGGTTACCAGGAG TTGGAAGCGGTTACCAGGAG KJ939267 GGGTTGCTGAAGATGGAATG TTCTCCTTGACCTGGGACTT β-AS CYP716A47 JN604537 AGGAGAACCGATGGCAATCTTGTG CGTTGATCTGTTGTTGGCGATTCC CYP716A53v2 JX036031 CAACATCCTTAGCAGGCGAGAA AGCGACTCTGACATAGCGAAAG CYP716A52v2 JX036032 AGGCTTCAGCAACACAAGACAT GCACTTCACAGGCTACATTCCA UGT94Q2 MH673780 ATG GATCTCTTTATCTCATCTCAA TTAAAGCGTACAAGGTGATAGACG GAPDH-1 KF699323 GGTGTAACCTAAGATTCCCTTGAGT ACTGTCAGGTTGGCGAAGAAG sequences were imported into MEGA software V 7.0 for The results revealed the following. First, low tempera- protein sequence comparison and phylogenetic tree con- ture (17°C) was more suitable for the generation of Panax struction. The results were transformed into an NWK file callus. Second, lower-latitude native Panax specie (SQ) and then visualized using the iTOL tool. was more adaptable than mid-latitude Panax species (ZJS and ZZS) and high-latitude Panax species (RS and XYS) under high culture temperatures (24°C and 30°C). RS Results and XYS (high latitude) were more suitable for growth in Morphological analysis of Panax callus low-temperature environments and were not adaptable to higher temperatures. ZJS and ZZS (middle latitude) The growth process of the ginseng plant callus cultures could withstand normal temperatures (24°C) but do not was monitored, and the cultivation status of each callus tolerate high temperatures (30°C), while SQ grew well was quantified as follows. First, the induction ratio (60% in all three environmental settings. Therefore, the lowest weight) was evaluated based on the proportion of success- temperature (17°C) was selected for the further study of fully induced callus. Second, the non-browning index (20% the callus growth of different Panax plants in the same weight) was determined by counting the proportion of environment; SQ was selected for the observation of the non-browning callus. Lastly, the growth status of the callus effect of culture temperature on callus growth. (20% weight) was determined based on its appearance, size, and growth speed. The results are recorded in Figure 1A. The regulation of the callus growth period was recorded The total yield of saponins from Panax crude herb and callus as follows (Figure 1B): the callus cells began to grow The 75% ethanol crude extracts of 1.0 g Panax plants around the 20th day. The callus was in the rapid growth stage between the 25th to 35th day and entered the growth were as follows: 245.3 mg (ZJS), 175.1 mg (ZZS), 266.3 mg (XYS), 202.4 mg (RS), and 191.9 mg (SQ). stagnation stage after the 35th day. The appearance of the callus remained unchanged at this stage, and the callus The purified total saponins were 149.2 mg (ZJS), 158.6 mg (ZZS), 45.6 mg (XYS), 91.7 mg (RS), and samples were harvested on the 40th day. The fresh Panax plant radixes and callus growth under different environ- 136.2 mg (SQ) and the purified total saponins yields were 14.9, 15.9, 4.6, 9.2, and 13.6%, respectively. ments was recorded as shown in Figure 1C. The appear- ance of the Panax callus after 45 d is shown in Figure 1D. The results showed that the total saponin content in Figure 1. Morphological analysis of Panax callus. (A) Comprehensive score of callus; (B) appearance of Panax callus growth at 17°C; (C) appear- ance of Panax callus (40 d of growth); (D) appearance of Panax callus after 45 d of growth. ZJS: Panax japonicas; ZZS: Panacis majoris rhizome; RS:Ginseng; SQ:Notoginseng. The samples grown at 17°C were named 17ZJS, 17ZZS, 17XYS, 17RS, and 17SQ, and the P. notoginseng sample placed at 24°C was named 24SQ, while the one at 30°C was named 30SQ. 264 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com Identification of sample composition by HPLC–MS 2-year-old Panax herbs was the highest for ZZS and ZJS, followed by SQ, while the yields from XYS and The HPLC–MS fingerprints of the 12 samples (ZJS, ZZS, RS were comparatively lower. With the same method RS, XYS, SQ,17ZJS,17 ZZS, 17RS, 17XYS, 17SQ, 24SQ, used, the total saponins yields from 0.1 g of 40-day- 30SQ) were recorded (Figure 2). More than 23 peaks were old Panax callus samples were as follows: 10.2 mg separated by HPLC, 19 of them were identified by mass (17ZJS), 1.8 mg (17ZZS), 5.3 mg (17XYS), 5.4 mg [27–28] spectrometry according to literatures and reference (17RS), 14.0 mg (17SQ), 10.3 mg (24SQ), and 7.4 mg substances. The main peak area was recorded (Table 3). (30SQ), and the total saponins yields were 10.3, 1.80, 5.3, 5.4, 14.0, 10.3, and 7.4%. At 17°C, SQ Anti-inflammatory analysis grew slowly and accumulated fewer metabolites. The results showed that the ginsenosides of SQ accumu- Studies have shown that endogenous nitric oxide (NO) lated faster, to a greater extent, at 17°C than at 24°C can cause NF-κB nitration, reduce its binding activity with [29] and 30°C, indicating that a low temperature may play DNA , weaken the inflammatory response cascade, inhibit a role in regulating the synthesis and accumulation of the degradation of IkB-ɑ, indirectly inhibit the activity of ginsenosides. NF-κB, and reduce the release of inflammatory mediators Figure 2. HPLC–MS chromatograms of experimental samples. ZJS: Panax japonicas; ZZS: Panacis majoris rhizome; RS:Ginseng; SQ:Notoginseng. The samples grown at 17°C were named 17ZJS, 17ZZS, 17XYS, 17RS, and 17SQ, and the P. notoginseng sample placed at 24°C was named 24SQ. 265 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com Table 3 Chromatographic spectral peaks area of HPLC–MS of samples P1-P23 represents 1-23 ginsenosides in the chromatogram Samples 5 + Peak area (×10 ) Compound name (m/z) [M + H] ZJS 17ZJS RS 17RS XYS 17XYS ZZS 17ZZS SQ 17SQ 24SQ 30SQ P1 G-Rh1 638.4 683.4 28.499 10.332 47.816 30.373 82.382 12.907 12.348 17.207 36.291 16.273 23.984 17.364 P2 unknown — 367.1 11.290 1.603 0.984 1.284 — 1.880 — 2.983 2.941 1.900 1.649 — P3 KG-R2 769.3 771 7.594 — — — — — — — 1.954 — — — P4 NG-R1 931.5 933.131 — — — — — — — — 14.129 10.642 5.169 3.926 P5 G-Rg1 799.5 801.01 18.834 — 9.361 — 3.170 — — — 192.325 166.427 123.599 94.403 P6 G-Rf 799.5 801.01 26.683 — 5.400 — 2.151 — — — 63.060 47.661 32.105 30.825 P7 G-Ro 955.5 957.1 122.915 71.404 — — — — 18.256 5.509 — — — — P8 G-Rb2/G-Rb3 1 123.6 1 124.5 — — — — — — 7.391 1.853 — — — — P9 Pseudo-G-Rt1 925.8 926.5 — — — — — — 60.915 25.631 — — — — P10 ChikusetsuIva 925.8 926.5 93.151 84.902 — — — — 185.264 28.789 — — — — P11 Chikusetsusaponin IVa 793.4 794.9 52.688 28.785 — — — — 26.982 12.996 — — — — P12 unknown — 311.1 — — — — — — — — 8.944 — — — P13 G-Rg2 783.3 785.01 — — — — — — — — 13.972 4.574 2.164 — P14 Pseudo-RT1 925.8 926.5 8.644 — — — — — — — — — — — P15 G-Rb1 1 107.5 1 109.3 1.625 — — — — — — — 94.335 79.156 76.429 70.191 P16 G-Re 945.5 947.14 — — — — — — — — 25.898 15.332 8.880 9.680 P17 G-Rd 945.3 947.14 — — — — — — — — 14.098 13.279 2.116 3.148 P18 G-Rg3 783.3 785.01 — — — — — — — — 2.426 — — — P19 CS IVa 793.3 794.9 — — — — 9.688 — 1.906 — 5.766 — — — P20 unknown — 339.1 6.885 2.296 5.658 — — — 2.377 — — — — — P21 unknown — 339.2 10.376 48.067 19.771 112.892 73.596 73.674 68.073 2.108 28.828 37.167 59.436 7.578 P22 Notoginsenoside R1 932.4 933.1 14.339 44.487 13.278 — 15.734 36.000 11.023 4.777 14.896 77.856 28.817 — P23 G-Rh6/Floral-GKa 670.4 671.4 30.334 13.763 39.124 — 68.760 8.296 19.073 3.078 31.535 37.684 25.838 13.307 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com Figure 3. Anti-inflammatory activity of Panax plants in vitro. (A) Inhibitory effect of drugs on LPS-induced NO release from RAW264.7 macrophages; (B) No release was detected when concentration of crude drug was 2.5 mg/mL; *P < 0.05, **P < 0.01, and ***P < 0.001 versus the LPS group (MX). ZJS: Panax japonicas; ZZS: Panacis majoris rhizome; RS:Ginseng; SQ:Notoginseng; The samples grown at 17°C were named 17ZJS, 17ZZS, 17XYS, 17RS and 17SQ, and the P. notoginseng sample placed at 24°C was named 24SQ, while the one at 30°C was named 30SQ. [30] such as IL-1 and IL-6 . Therefore, the amount of released caused by environmental changes. TCM is complex, with NO is positively correlated with the inhibition of the multiple components and targets. Multiple components inflammatory response. While Panax plants have similar regulate the overall efficacy of TCM; thus, gray correlation anti-inflammatory effects, the effects may vary according to theory is suitable for revealing the effects of the ingredients the species and growth environment. The results recorded in TCM. The GCD of “component-NO reduction efficacy” in Figure 3A show the inhibitory effect of the drugs on LPS- is recorded in Table 4. According to the results, the com- induced No release from the RAW264.7 macrophages. In ponents with GCD higher than 0.8 are P1 (G-Rh1), P21 contrast, Figure 3B showed that with the same concentra- (unknown), P2 (unknown), P23 (G-Rh6/Floral-GKa), P20 tion of crude drug (2.5 mg/mL), all 12 samples effectively (unknown), P15 (G-Rb1), and P18 (G-Rg3). inhibited NO synthesis in macrophages after LPS induction. The anti-inflammatory effect among the Panax plants was Regulation of Ginsenosides on inflammatory factor gene RS > ZJS > XYS > ZZS > SQ, and the anti-inflammatory The specific components G-Rh1, G-Rb1, and G-Rg3 were effect on callus grown in the same environment was 17Z JS > 17ZZS ≈ 17XYS > 17RS > 17SQ. The anti-inflamma- administered to RAW264.7 cells induced by LPS at a 50 µg/ mL concentration. Twenty-four hours later, the gene expres- tory effect of P. notoginseng callus under different tempera- tures was as follows: 24SQ > 17SQ > 30SQ. These results sion levels of inflammatory factors and cytokines were determined by qRT-PCR. The internal reference gene was indicated that under natural growth environments, the anti-inflammatory effect of RS was more potent than that GADPH, and the blank group served as the control group. The growth trend of −△△Ct was used to represent the trend of the other species when cultured at the same temperature of 17°C. ZJS, ZZS, and XYS callus exhibited the strongest in gene expression. The results were recorded in Figure 4. Figure 4 shows that compared with the LPS group (MX), anti-inflammatory effects, which may be due to the suit- able growth conditions for these three herbs. RS may prefer G-Rg3, G-Rb1, and G-Rh1 in Panax plants can inhibit the gene expression of the pro-inflammatory mediators (IL-1β , a lower temperature and SQ a higher temperature, based on their latitude distribution. The results indicated that the IL-6, TNF-ɑ), chemokines (MCP-1, CXCL10), and cyto- kines (TGF-β1), or inhibit the expression of the proteolytic best for growth of SQ callus is 24°C. Higher or lower tem- peratures are not conducive to its growth, thus reducing its enzyme MMP-9 from maintaining strong anti-inflamma- tory activities. In summary, these results fully verify the anti-inflammatory effect. effectiveness of the three selected components. “Component-efficacy” relational analysis qRT-PCR analysis The differences in the anti-inflammatory effects within the same environment and between different backgrounds are From the above experiments, we deduced that P1, mainly due to the differences in metabolite accumulation P21, P2, P23, P20, P15, and P18 led to the differences Table 4 The result of “component- NO reduction” gray correlation analysis Peak P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 GCD 0.8665 0.8482 0.7963 0.7798 0.7618 0.7753 0.7934 0.7988 0.7809 0.7877 0.7960 0.7804 peak P13 P14 P15 P16 P17 P18 P19 P20 P21 P22 P23 GCD 0.7966 0.7849 0.8131 0.7932 0.7971 0.8031 0.7874 0.8262 0.8650 0.7992 0.8424 GCD: Gray correlation degree. 267 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com Figure 4. Inhibitory effect of drugs on LPS-induced expression of inflammatory cytokines and chemokines in RAW264.7 macrophages. *P < 0.05, # ## ### **P < 0.01, and ***P < 0.001 versus the control group (KB). P < 0.05, P < 0.01, and P < 0.001 versus the LPS group (MX). Figure 5. Biosynthesis of ginsenosides. HMG-CoA, 3-hydroxy-3-methylglutaryl-CoA; MEP, 2-C-methyl-D erythritol 4-phosphate; HMGR, 3-hydroxy- 3-methylglutaryl-CoA reductase; SS, squalene synthase; SE, squalene epoxidase; UGT, UDP glycosyltransferases. The two-way arrow indicates the reactions are reversible, and the green represents ginsenoside. The other colors represent various intermediates. Arrow represents the direction of the reaction, and the others are catalytic enzymes and transcription factors in the synthesis process. in the anti-inflammatory efficacy of Panax plants. of the plants. Previous studies have shown that gin- Finding genes conducive to accumulating these com- senoside biosynthesis is regulated by many genes ponents may improve the anti-inflammatory effects (Figure 5). 268 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com “Gene-component” gray relational analysis This work selected five reportedly key genes in ginsenoside synthesis, i.e., SS, β-As, UGT94Q2, The relative component contents of Panax herb and cal- CYP76A47, and CYP76A53v2, as target genes. The lus samples were correlated with CYP76A53v2, SS, β-As, expression of these genes was detected by a quanti- CYP76A47, and UGT94Q2 using the gray relational tative fluorescence analyzer, with SQ as the control analysis method. The gray correlation degree results sample and GAPDH as the reference gene. The results were recorded in Figure 7. The results showed that P1, of the Panax herb and callus samples were recorded in P23, and P2 were affected most by the relative expression Figure 6A and 6B. of CYP76A53v2. CYP76A53v2 may be the key tran- The gene expression results of fresh Panax plant scription factor controlling ginsenosides G-Rh1, G-Rf, radixes in Figure 6A indicated that the expression and G-Re. P7, P23, P2, P4, P21, and P16 made a large of CYP76A53v2 and β-As was slightly higher in ZJS contribution to the gene β-As, and the correlation degree than in the other samples, while the expression of of the other components was lower than 0.8. Therefore, β-As in ZZS was lower than in the others. Figure 6B β-As may control the synthesis of G-R0, G-Rh6/Floral- showed that the expression of ginsenoside synthe- GKa, NG-R1, G-Re, P2, and P21 (unknown). P1, P18, sis genes in the callus was higher than the Panax P13, P16, P6, P5, P2, and P21 contributed the most to plant radixes in Figure 6A, especially for SS and the relative expression of UGT94Q2, which may con- UGT94Q2. Moreover, the gene expression of the trol the synthesis of G-Rh1, NG-R1, G-Rg3, G-Rg2, SS-CYP76A47-UGT94Q2/CYP76A53v2 pathway G-Re, G-Rg1, and P21 (unknown). Similarly, the synthe- was increased under the callus culture condition, sis of G-Rh1, P21(unknown), G-Rf, G-Rh6/Floral-GKa, especially the upstream gene SS and the downstream NG-R1, G-Rg1, G-Re, and G-Rg3 may be controlled by genes UGT94Q2 and CYP76A53v2. The expres- CYP76A47 and the gene SS may be the key transcrip- sion of the intermediate gene CYP76A47 increased tion factor influencing G-Rf, G-Rg1, NG-R1, G-Re, in most samples but reduced in others, such as G-Rh6/Floral-GKa, G-Rh1, G-Rg2, G-Rd, and G-Rb1. 17ZZS, 17XYS, and 24SQ. These results, in combi- In conclusion, the “gene-component” GCA method can nation with the LC/MS results, revealed that there be used to preliminarily determine the regulatory roles were hardly any significant compounds in 17XYS, of transcription factors in the synthesis of ginsenosides. indicating that CYP76A47 is the key enzyme gene This information may be useful to specifically upregulate in Panax plants. The result showed that β-As was the expression of target genes and improve the contents downregulated under the current culture conditions, of active ingredients. Thus, this method provided a new and these results, combined with the LC/MS results, analytical approach for studying fresh medicinal materi- indicated that this condition was unfavorable for the als in the life sciences. The results showed multiple genes synthesis of pentacyclic triterpene. participate in the regulation of saponins, and one gene The gene expression patterns in the plants varied due may affect multiple saponins synthesis. to climatic conditions. The gene expression levels of con- generic species may also differ under the same climatic Homology analysis conditions. Generally, there is a “multi to multi” relation- Uridine diphosphate (UDP)-dependent glycosyltransfer- ship between gene regulation and metabolism of com- ases (UGTs) constitute a huge hypergene family. UGTs ponents; this means that multiple genes may commonly contain the key enzyme genes of the ginsenoside bio- regulate the biosynthetic pathway of a component, and synthesis pathway and participate in the metabolism of one gene could also participate in the synthesis of mul- many species. In the ginsenoside biosynthesis pathway, tiple components. To detect the “gene regulation-com- UGTs mainly catalyze the connection between glyco- ponent metabolizing” relationship, callus culture was sides and ginsenosides, extend the glycopeptide chain, adopted to amplify the gene expression and component and transfer glycosyl. The UGT family of Panax is accumulation differences under different culture condi- closely related to that of other plants. The phylogenetic tions, and GCA was adopted to discover the potential tree is built according to the affinity of the homologous regulation laws. Figure 6. Effect of key gene expression on component accumulation. (A) Relative gene expression levels in fresh Panax plants radixes; (B) relative gene expression levels in Panax callus. ZJS: Panax japonicas; ZZS: Panacis majoris rhizome; RS:Ginseng; SQ:Notoginseng. The samples grown at 17°C were named 17ZJS, 17ZZS, 17XYS, 17RS, and 17SQ, and the P. notoginseng sample placed at 24°C was named 24SQ, while the one at 30°C was named 30SQ. 269 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com Figure 7. Correlation between key enzymes and ginsenoside synthesis. proteins of Panax (pg) is closely related to other gen- “tonifying qi,” promoting blood circulation, and remov- era. This sentence is not required because it repeats the ing blood stasis. This phenomenon is known as the “cli- previous sentence. Figure 8 showed that 21 representa- mate effect efficacy theory”; just as the old saying goes, tive UGT metabolic enzymes of Panax were represented all things are born in different climates, and each has its [31] in the phylogenetic tree, each marked with blue. Each deviation . UGT gene from Panax plants was used to research other This study used callus cultures to clarify the influence homologous UDP glycosyltransferases. These cluster of climatic conditions on the efficacy of Panax plants. into nine groups, with each group, denoted with one Callus cultures of Panax plants were grown under differ- color. The results show that, like other plants, the UGTs ent and the same conditions. Subsequently, the chemical in Panax plants are highly similar; these three UGTs components were detected (HPLC–MS), the anti-inflam- are known transferases for ginsenoside synthesis. The matory activity of each sample was evaluated (qRT- members of the UGT family are related, and the amino PCR), and GCA and homology analysis was performed acid sequences are highly similar to those of other spe- to observe the differences and similarities in drug effi- cies. After comparing the sequences of the UGT super- cacy, chemical components, and gene expression. gene family, candidate genes for saponin synthesis were Plant tissue culture is the process by which plant tis- screened through homology. sue is grown aseptically in a nutrient-rich matrix in a climate-controlled incubator. This approach ensures the plant growth environment is controllable and reduces Discussion environmental diversity. It is an effective way to obtain [32] The efficacy of Chinese herbal medicine (CHM) is ginsenosides quickly . For callus induction, growth, affected by many factors, such as germplasm, origin, cli- and metabolism of Panax require a suitable environ- [33–34] mate, processing factors, etc. Even species of the same ment , an environmental change will inevitably lead genus grown in different environments will have differ- to a change in the plant's medicinal properties because ent efficacies. For example, among the Panax plants used Panax's growth depends on the climate to a great [35] in this study, it is believed that SQ, which is distributed extent . Moreover, the climate and development of the in low latitudes, is good at promoting blood circulation plant affect the synthesis of the bioactive components and removing blood stasis. RS and XYS, distributed at in Panax. To cope with changes in the local ecological higher latitudes, are good at “tonifying qi.” ZZS and environment, plants of the same genus from different ZJS are distributed in middle latitudes and are good at habitats will selectively express relevant dominant genes. 270 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com Figure 8. Phylogenetic tree of UGT gene family in Panax. The accession numbers of ginsenoside synthesis gene UGT family are as follows: CAUGT2 (BAD29722), UGT708C1 (BAP90360), UGT708C2 (BAP90361), UGT709C2 (BAO01109), UGT73C10 (AFN26666), UGT73C11 (AFN26667), UGT74AC1 (AEM42999), UGT74AE2 (AGR44631), UGT75L6 (BAK55736), UGT84A13 (AHA54051), UGT85A19 (ABV68925), UGT85A23 (BAK55749), UGT85A24 (BAK55737), UGT85K4 (AEO45781), UGT85K5 (AEO45782), UGT94E5 (BAK55744), UGT94Q2 (AGR44632), UGTCs2 (AAP94878), UGTPg1 (AIE12479), UGTPg100 (AKQ76388), UGTPg101 (AKQ76389).The regions with the same color represent a group of proteins with close homology, and the numbers on the phylogenetic tree represent interspecific relationships. The larger the number is, the closer their genetic relationships are Dcr, jre, and vvi represent Org codes of carrot, walnut, and grape, respectively. Plant tissue culture technology can reduce the difficulty task. Thus, to address this difficulty, the qRT-PCR/LC– of comparative analysis of plants of the same genus from MS GCA method may become a new screening method [36–38] different areas . for life science research. Genes that played key roles in ginsenoside synthe- sis, including SS, β-As, UGT94Q2, CYP76A47, and Conclusions CYP76A53v2, were chosen for this study. For example, SS was synthesized by two farnesyl diphosphate mole- The anti-inflammatory efficacy/LC–MS correlation cules, and β-As participates in the mevalonate pathway results showed that G-Rh1, G-Rb1, G-Rg3, G-Rh6/ [39] of ginsenoside biosynthesis . UGT94Q2 was the regu- Floral-GKa, P2, P20, and P21 (unknown) contributed [40] latory enzyme of ginsenoside biosynthesis . CYP76A47 the most to the anti-inflammatory effect of Panax plants. could oxidize C-12 of dammarenediol to produce PPD, It was inferred that they might be the main effective com- and then further hydroxylate C-6 through CYP76A53v2 ponents. The gene-component correlation results showed [41–45] to produce PPT . that the expression of CYP76A47 was affected most by More than 190 types of ginsenosides have been found the accumulation of the anti-inflammatory components [46] in Panax plants . There are 226 UGTs in RS and 127 and then improved the anti-inflammatory efficacy of [47–48] in SQ . However, only 34 have been confirmed to Panax plants. Subsequently, to identify other enzymes [49] participate in the biosynthesis of ginsenosides . For that may regulate saponin synthesis, a phylogenetic tree example, the ginsenoside Rg3, with strong anticoagulant was constructed for homology analysis. Therefore, com- activity, is produced by PgUGT94Q2 and its homologs pared with experimental screening, “anti-inflammatory catalyzing ginsenoside Rh2 to transfer glucose on C-3 in component-efficacy” correlation analysis can effectively [50] G-Rh2 to the C-2ʹ hydroxyl group . UGT71A29 has screen the pharmacodynamic substances, and “gene-com- a high similarity (96.47%) with UGTPg1 at the amino ponent” correlation analysis can effectively filter the reg- [51] acid level and can glycosylate G-Rh1 and G-Rd to ulatory components of characteristic enzymes. At the [52] produce G-Rg1 and G-Rb1 respectively . While they same time, phylogenetic tree analysis helps find other all belong to the UGT family, their functions differ. enzymes regulating ginsenoside synthesis. This research Exploration of how UGT family members participate in established a novel and effective strategy for identifying regulating ginsenoside synthesis is a crucial but difficult key genes and active anti-inflammatory ingredients in 271 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com [13] Nicholas D, Yen OC, Andrew S, et al. Candidate genes modu- Panax medicinal plants. The study used climate-regu- lating reproductive timing in elite us soybean lines identified in lated callus culture combined with gene-component-effi- soybean alleles of Arabidopsis flowering orthologs with divergent cacy GCA. This analysis could be used as a reference for latitude distribution. Front Plant Sci 2022;13:889066. [14] Hang JW, Jing XC, Li B, et al. Effects of shading on gene assessing the medicinal properties of other herbs. expression of key enzymes in saponin synthesis and saponin accumulation of Panax japonicus. Chin J Chinese Mater Med 2018;43(19):3855–3861. Conflict of interest statement [15] Jiang ML, Liu J, Quan X, et al. Different chilling stresses stimu- The authors declare no conflict of interest. lated the accumulation of different types of different types of gin- senosides in Panax ginseng cells. Acta Physiol Plant 2016;38:210. [16] Zhang T, Chen CB, et al. Changes in the leaf physiological charac- teristics and tissue-specific distribution of Ginsenosides in Panax Funding ginseng during flowering stage under cold stress. Front Bioeng This work was supported by National Natural Science Biotechnol 2021;9:637324. [17] Kim YJ, Zhang DB, Yang DC. Biosynthesis and biotechnological Foundation of China grants (No. 81773893); National Major production of ginsenosides. Biotechnol Adv 2015;33:717–735. Scientific and Technological Special Project for “Significant [18] Deng B, Zhang P, Ge F, et al. Enhancement of triterpenoid sapo- New Drugs Development” (No. 2017ZX09301060001); nins biosynthesis in Panax notoginseng cells by co-overexpres- Hubei Province Key R&D Programme (No. 2020BED017 sions of 3-hydroxy-3-methylglutaryl CoA reductase and squalene synthase genes. Biochem Eng J 2017;122:38–46. and 2020BGB004); Jiangxi Province “Thousand Talents [19] Wang HP, Zhang YB, Yang XW, et al. Rapid characterization of Plan” of Scientific and Technological Innovation (No. ginsenosides in the roots and rhizomes of Panax ginseng by UPLC- JXSQ2019201105); Fundamental Research Funds for DAD-QTOF-MS/MS and simultaneous determination of 19 gin- senosides by HPLC-ESI-MS. J Ginseng Res 2016;40(4):382–394. the Central Universities “South-Central University for [20] Chena YH, Lu YM, Yang Y, et al. Determination of ginsenoside Nationalities” (No. CZP20025 and No. CZP20047). compound K in human plasma by liquid chromatography–tan- dem mass spectrometry of lithium adducts. Acta Pharmaceutica Sinica B 2015;5(5):461–466. Author contributions [21] Wang YF, Peng MY, Wang WJ, et al. Verification of miRNAs in ginseng decoction by high-throughput sequencing and quantita- Yongshen Ren conceived and designed the experiments. tive real-time PCR. Heliyon 2019;5(4):e0141801418. Jiao Ai, Linlin Chen, Long Cheng, Majing Jiao, Yanqiu [22] Zhu T, Wu TL, Cai BC, et al. Investigation on relationships Li, Yingzhou Wang, and Xing Deng performed the exper- between chemical spectrum and bioeffect of prepared rhubarb decoction in rats by UPLC-ESI- Q-TOF-MS method coupled with iments. Jiao Ai and Yongshen.Ren analyzed the data. grey correlation analysis. J Funct Foods 2017;31:104–112. Jiao Ai and Yongshen Ren wrote and reversed the paper. [23] Wang D, Fu JF, Liu XR, et al. Transcriptome analysis of Sclerotinia ginseng and comparative analysis with the genome of Sclerotinia sclerotiorum. Physiol Mol Plant Pathol 2018;106:30–41. Ethical approval of studies and informed consent [24] Zhang JY, Sun HJ, Song IJ. Plant regeneration of Korean wild gin- seng (Panax ginseng Meyer) mutant lines induced by yirradiation Not applicable. (60 Co) of adventitious roots [J]. Journal of adventitious roots [J]. J Ginseng Res 2014;63(2):44–47. [25] Zhao JJ, Roy P, Tang HM, et al. Indole derivative XCR-5a Acknowledgments alleviates LPS-induced inflammation in vitro and in vivo. None. Immunopharmacol Immunotoxicol 2021;44(2):157–167. [26] Ao MT, Zhang JY, Qian YQ, et al. Design and synthesis of ada- mantyl-substituted flavonoid derivatives as anti-inflammatory Nur77 modulators: compound B7 targets Nur77 and improves References LPS-induced inflammation in vitro and in vivo. Bioorg Chem [1] Adil M, Jeong BR. In vitro cultivation of Panax ginseng C.A. 2022;120:10564510564. Meyer. Ind Crop Prod 2018;122:239–251. [27] Yang WZ, Qiao X, Ye M, et al. Identification and differentiation [2] Jeong HC, Hong HD, Kim YC, et al. The research trend of ginseng of Panax ginseng, Panax quinquefolium, and Panax notogin- processing technology and the status of ginseng industry. Food Sci seng by monitoring multiple diagnostic chemical markers. Acta Ind 2012;45:59–67. Pharmaceutica Sinica B 2016;6(6):568–575. [3] Gao Y, Li J, Wang J, et al. Ginsenoside Rg1 prevent and treat inflam- [28] Huang X, Liu Y, Zhang Y, et al. Multicomponent assess- matory diseases: a review. Int Immunopharmacol 2020;87:106805. ment and ginsenoside conversions of Panax quinquefolium L. [4] Im DS. Pro-resolving effect of ginsenosides as an anti-inflamma- roots before and after steaming by HPLC-MS. J Ginseng Res tory mechanism of Panax ginseng. Biomolecules 2020;10:444. 2019;43(1):27–37. [5] Liu ZQ. Chemical insights into ginseng as a resource for natural [29] Medzhitov R. Toll-like receptors and innate immunity. Nat Rev antioxidants. Chem Rev 2012;112(6):3329–3355. Immunol 2001;1:135–145. [6] Leung KW, Wong ST. Pharmacology of ginsenosides: a literature [30] Cortez M, Carmo LS, Rogero MM, et al. A high-fat diet increases review. Chin Med 2010;5(1):20. IL-1, IL-6, and TNF-α production by increasing NF-κB and atten- [7] Ren YS, Ai J, Chen LL, et al. Anticoagulant active ingredients iden- uating PPAR-γ expression in bone marrow mesenchymal stem tification of total saponin extraction of different Panax medicinal cells. Inflammation 2013;36:379–386. plants based on grey relational analysis combined with UPLC-MS [31] Wang HG. Decoction Materia Medica. Beijing People’s Publishing and molecular docking. J Ethnopharmacol 2020;260:112955. House. 1992.6. [8] Yang WZ, Hu Y, Wu WY, et al. Saponins in the genus Panax [32] Pathak MC. Study on secondary metabolites produced from cal- L. (Araliaceae): a systematic review of their chemical diversity. lus cultures of Nicotiana tabacum by plant tissue culture tech- Phytochem 2014;106:7–24. niques. J Biotechnol 2019;305:S2121–S2S22. [9] Thorpe TA. History of plant tissue culture. Mol Biotechnol [33] Kolewe ME, Gaurav V, Roberts SC. Pharmaceutically active natu- 2007;37(2):169–180. ral product synthesis and supply via plant cell culture technology. [10] Efferth TH. Biotechnology Applications of Plant Callus Cultures. Mol Pharm 2008;5:243–256. Engineering 2019;5(1):50–59. [34] Choi YE. Origin of somatic embryoinduced from cotyledons of [11] Patricia B, Sébastien B, Shuyao K, et al. The evolutionary history of zygotic embryos at various developmental stages of ginseng. Plant small RNAs in Solanaceae. Plant Physiol 2014;189(2):644–665. Biol 1994;37(3):365–370. [12] Jenny YYL, Chun CP, Lawrence R, et al. Reproductive [35] Liu D, Li YG, Xu H, et al. Differentiation of the root of cultivated resource partitioning in two sympatric Goniothalamus species ginseng,mountain cultivated ginseng and mountain wild ginseng (Annonaceae) from Borneo: floral biology, pollinator trapping using FT-IR and two-dimensional correlation IR spectroscopy. J and plant breeding system. Sci Rep 2016;6:35674. Mol Struct 2008:228–235. 272 Ai et al. • Volume 2 • Number 4 • 2022 www.ahmedjournal.com [36] Pai AL, Whetten RW, Xiang QYJ. Ecological genomics of local [46] Shi ZZ, Zeng JZ, Wong AST. Chemical Structures and adaptation in Cornus florida L. by genotyping by sequencing. Pharmacological Profiles of Ginseng Saponins. Molecules Ecol Evol 2016;7(1):441–465. 2019;24(13):2443. [37] Yun L, Yun Y, Guang TP, et al. New insights into tissue [47] Kim NH, Jayakodi M, Lee SC, et al. Genome and evolution of the culture plant-regeneration mechanisms. Front Plant Sci shade-requiring medicinal herb Panax ginseng. Plant Biotechnol J 2022;2022:926752. 2018;16(11):1904–1917. [38] Thomas E. Biotechnology applications of plant callus cultures. [48] Zhang D, Li W, Xia EH, et al. The medicinal herb Panax notogin- Engineering 2019;5(1):50–59. seng genome provides insights into ginsenoside biosynthesis and [39] Kushiro T, Shibuya M, Masuda K, et al. Mutational studies on genome evolution. Mol Plant 2017;10(6):903–907. triterpene synthases: Engineering lupeo synthase into β-amyrin [49] Yang JL, Hu ZF, Zhang TT, et al. Progress on the studies of the key synthase. J Am Chem Soc 2000;122:6816–6824. enzymes of ginsenoside biosynthesis. Molecules 2018;23(3):589. [40] Xu S, Zhao C, Wen G, et al. Longitudinal expression patterns of [50] Wang P, Wei Y, Fan Y, et al. Production of bioactive ginsenosides HMGR, FPS, SS, SE and DS and their correlations with saponin Rh2 and Rg3 by metabolically engineered yeasts. Metab Eng contents in green-purple transitional aerial stems of Panax noto- 2015;29:97–105. ginseng. Ind Crop Prod 2018;119:132–143. [51] Hou MQ, Wang RF, Wang ZT. Ginsenosides in Panax [41] Yang C, Li C, Wei W, et al. The unprecedented diversity of UGT94- genus and their biosynthesis. Acta Pharmaceutica Sinica B family UDP-glycosyltransferases in Panax plants and their contri- 2021;11(7):1813–1834. bution to ginsenoside biosynthesis. Sci Rep 2020;10:15394. [52] Lu J, Yao L, Li JX, et al. Characterization of UDP- [42] Fukushima EO, Seki H, Ohyama K, et al. CYP716A subfamily glycosyltransferase involved in biosynthesis of ginseno- members are multifunctional oxidases in triterpenoid biosynthe- sides Rg1 and Rb1 and identification of critical conserved sis. Plant Cell Physiol 2011;52:2050–2061. amino acid residues for its function. J Agric Food Chem [43] Carelli M, Biazzi E, Panara F, et al. Medicago truncatula CYP716A12 2018;2018:9446–9449. is a multifunctional oxidase involved in the biosynthesis of hemo- lytic saponins. Plant J Pre-proof Cell 2011;23:3070–3081. [44] Moses T, Pollier J, Faizal A, et al. Unraveling the triterpenoid How to cite this article: Ai J, Ren YS, Cheng L, Liu XQ, Li YQ, Jiao MJ, saponin biosynthesis of the African shrub Maesa lanceolata. Mol Wang YZ, Deng X, Chen LL. Identification of key genes and active anti- Plant 2015;8:122–135. inflammatory ingredients in Panax medicinal plants by climate-regulated [45] Tamura K, Seki H, Suzuki H, et al. CYP716A179 functions as a callus culture combined with gene-component-efficacy gray correlation triterpene C-28 oxidase in tissue-cultured stolons of Glycyrrhiza analysis. Acupunct Herb Med 2022;2(4):261–273. doi: 10.1097/ uralensis. Plant Cell Rep 2017;36:437–445. HM9.0000000000000049
Journal
Acupuncture & Herbal Medicine – Wolters Kluwer Health
Published: Dec 26, 2022